SZGR2

Summary ?

GeneID	4926
Symbol	NUMA1
Synonyms	NMP-22\|NUMA
Description	nuclear mitotic apparatus protein 1
Reference	MIM:164009\|HGNC:HGNC:8059\|Ensembl:ENSG00000137497\|HPRD:01236\|Vega:OTTHUMG00000167697
Gene type	protein-coding
Map location	11q13
Pascal p-value	0.054
Fetal beta	0.257
Support	CompositeSet Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0036

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
NUMA1	chr11	71725854	C	T	NM_006185	p.899A>T	missense			Schizophrenia	DNM:Fromer_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C4orf8	0.92	0.95
NASP	0.91	0.91
CLK2	0.91	0.93
FTSJ3	0.91	0.93
DNAJC9	0.91	0.92
RUFY1	0.91	0.92
PAXIP1	0.91	0.93
BRD8	0.91	0.92
XRCC1	0.91	0.92
SRRT	0.91	0.93

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.74	-0.86
AF347015.27	-0.72	-0.85
MT-CO2	-0.71	-0.84
IFI27	-0.70	-0.83
AF347015.33	-0.69	-0.81
FXYD1	-0.69	-0.81
C5orf53	-0.68	-0.72
HLA-F	-0.68	-0.72
MT-CYB	-0.68	-0.80
COPZ2	-0.67	-0.76

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		15537540
GO:0005198	structural molecule activity	TAS		1541630
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000090	mitotic anaphase	TAS		1541636
GO:0006997	nucleus organization	TAS		1541630
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000922	spindle pole	IDA		14718566
GO:0005876	spindle microtubule	TAS		1541636
GO:0005634	nucleus	TAS		1541636

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTR1A	ARP1 \| CTRN1 \| FLJ52695 \| FLJ52800 \| FLJ55002	ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)	-	HPRD,BioGRID	10504299
EPB41	4.1R \| EL1 \| HE	erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)	-	HPRD,BioGRID	10189366
EPB41L1	4.1N \| DKFZp686H17242 \| KIAA0338 \| MGC11072	erythrocyte membrane protein band 4.1-like 1	-	HPRD,BioGRID	10594058
EPB41L2	4.1-G \| DKFZp781D1972 \| DKFZp781H1755	erythrocyte membrane protein band 4.1-like 2	-	HPRD,BioGRID	12239178
GNAI1	Gi	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1	NuMA interacts with Galphai1.	BIND	15537540
GPSM2	LGN \| Pins	G-protein signaling modulator 2 (AGS3-like, C. elegans)	-	HPRD,BioGRID	11781568
GPSM2	LGN \| Pins	G-protein signaling modulator 2 (AGS3-like, C. elegans)	LGN interacts with NuMA.	BIND	15537540
NCOA6	AIB3 \| ANTP \| ASC2 \| HOX1.1 \| HOXA7 \| KIAA0181 \| NRC \| PRIP \| RAP250 \| TRBP	nuclear receptor coactivator 6	-	HPRD,BioGRID	12519782
PIM1	PIM	pim-1 oncogene	-	HPRD,BioGRID	12111331
RAD21	FLJ25655 \| FLJ40596 \| HR21 \| HRAD21 \| KIAA0078 \| MCD1 \| NXP1 \| SCC1 \| hHR21	RAD21 homolog (S. pombe)	-	HPRD	11590136
SMC1A	CDLS2 \| DKFZp686L19178 \| DXS423E \| KIAA0178 \| MGC138332 \| SB1.8 \| SMC1 \| SMC1L1 \| SMC1alpha \| SMCB	structural maintenance of chromosomes 1A	-	HPRD,BioGRID	11590136
SMC3	BAM \| BMH \| CDLS3 \| CSPG6 \| HCAP \| SMC3L1	structural maintenance of chromosomes 3	Affinity Capture-Western	BioGRID	11590136
TNKS	PARP-5a \| PARP5A \| PARPL \| TIN1 \| TINF1 \| TNKS1	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	-	HPRD,BioGRID	12080061
YEATS4	4930573H17Rik \| B230215M10Rik \| GAS41 \| NUBI-1 \| YAF9	YEATS domain containing 4	-	HPRD,BioGRID	10913114

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA HIVNEF PATHWAY	58	43	All SZGR 2.0 genes in this pathway
BIOCARTA RANMS PATHWAY	10	7	All SZGR 2.0 genes in this pathway
PID CASPASE PATHWAY	52	39	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE	421	253	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE MITOTIC	325	185	All SZGR 2.0 genes in this pathway
REACTOME RECRUITMENT OF MITOTIC CENTROSOME PROTEINS AND COMPLEXES	66	43	All SZGR 2.0 genes in this pathway
REACTOME RECRUITMENT OF NUMA TO MITOTIC CENTROSOMES	10	8	All SZGR 2.0 genes in this pathway
REACTOME MITOTIC G2 G2 M PHASES	81	50	All SZGR 2.0 genes in this pathway
HUTTMANN B CLL POOR SURVIVAL UP	276	187	All SZGR 2.0 genes in this pathway
LIU CMYB TARGETS UP	165	106	All SZGR 2.0 genes in this pathway
RODRIGUES NTN1 TARGETS DN	158	102	All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS GREEN DN	25	12	All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING DN	58	35	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B	392	251	All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 23	24	13	All SZGR 2.0 genes in this pathway
YANG BREAST CANCER ESR1 UP	36	22	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
LOCKWOOD AMPLIFIED IN LUNG CANCER	214	139	All SZGR 2.0 genes in this pathway
ZHANG RESPONSE TO IKK INHIBITOR AND TNF DN	103	64	All SZGR 2.0 genes in this pathway
MORI SMALL PRE BII LYMPHOCYTE DN	76	52	All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO DN	200	112	All SZGR 2.0 genes in this pathway
SHEPARD BMYB TARGETS	74	41	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN	185	111	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP	390	242	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN	298	200	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN	178	121	All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS DN	142	94	All SZGR 2.0 genes in this pathway
URS ADIPOCYTE DIFFERENTIATION DN	30	20	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D DN	270	181	All SZGR 2.0 genes in this pathway
DE YY1 TARGETS DN	92	64	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
RUIZ TNC TARGETS UP	153	107	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
BAE BRCA1 TARGETS DN	32	27	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2	182	102	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
BILANGES SERUM SENSITIVE VIA TSC2	39	25	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
RATTENBACHER BOUND BY CELF1	467	251	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124/506	79	85	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	79	85	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-133	351	357	m8	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	351	357	m8	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-543	623	629	1A	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NUMA1