Gene Page: RASD1
Summary ?
GeneID | 51655 |
Symbol | RASD1 |
Synonyms | AGS1|DEXRAS1|MGC:26290 |
Description | RAS, dexamethasone-induced 1 |
Reference | MIM:605550|HGNC:HGNC:15828|Ensembl:ENSG00000108551|HPRD:08958|Vega:OTTHUMG00000059292 |
Gene type | protein-coding |
Map location | 17p11.2 |
Pascal p-value | 0.019 |
Sherlock p-value | 0.011 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0018 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg06990298 | 17 | 17399700 | RASD1 | -0.029 | 0.27 | DMG:Nishioka_2013 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10929202 | chr2 | 237843949 | RASD1 | 51655 | 0.18 | trans | ||
rs1435845 | chr2 | 237848398 | RASD1 | 51655 | 0.2 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003924 | GTPase activity | TAS | 10471929 | |
GO:0005525 | GTP binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007186 | G-protein coupled receptor protein signaling pathway | TAS | 10840027 | |
GO:0007165 | signal transduction | TAS | 10471929 |10673050 | |
GO:0007264 | small GTPase mediated signal transduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS MAGENTA UP | 28 | 18 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER UP | 181 | 108 | All SZGR 2.0 genes in this pathway |
AMUNDSON GENOTOXIC SIGNATURE | 105 | 68 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
ZUCCHI METASTASIS DN | 44 | 29 | All SZGR 2.0 genes in this pathway |
UEDA CENTRAL CLOCK | 88 | 62 | All SZGR 2.0 genes in this pathway |
NADLER OBESITY DN | 48 | 34 | All SZGR 2.0 genes in this pathway |
RUAN RESPONSE TO TROGLITAZONE UP | 25 | 15 | All SZGR 2.0 genes in this pathway |
RUAN RESPONSE TO TNF TROGLITAZONE DN | 42 | 24 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
RUAN RESPONSE TO TNF DN | 84 | 50 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 5 | 126 | 78 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
CAMPS COLON CANCER COPY NUMBER UP | 92 | 45 | All SZGR 2.0 genes in this pathway |
ENGELMANN CANCER PROGENITORS UP | 48 | 31 | All SZGR 2.0 genes in this pathway |
LEE DOUBLE POLAR THYMOCYTE | 27 | 17 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 1 | 46 | 33 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-130/301 | 546 | 552 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-17-5p/20/93.mr/106/519.d | 548 | 555 | 1A,m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-30-5p | 501 | 508 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-365 | 396 | 403 | 1A,m8 | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
miR-375 | 583 | 590 | 1A,m8 | hsa-miR-375 | UUUGUUCGUUCGGCUCGCGUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.