SZGR2

Summary ?

GeneID	55870
Symbol	ASH1L
Synonyms	ASH1\|ASH1L1\|KMT2H
Description	ash1 (absent, small, or homeotic)-like (Drosophila)
Reference	MIM:607999\|HGNC:HGNC:19088\|Ensembl:ENSG00000116539\|HPRD:06416\|Vega:OTTHUMG00000014011
Gene type	protein-coding
Map location	1q22
Fetal beta	0.681
eGene	Meta
Support	CompositeSet Darnell FMRP targets Chromatin Remodeling Genes

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
GSMA_I	Genome scan meta-analysis	Psr: 0.0235
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00814
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
ASH1L	chr1	155452170	C	T	NM_018489	p.164R>H	missense			Schizophrenia	DNM:Fromer_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
GO:0003702	RNA polymerase II transcription factor activity	TAS		10860993
GO:0005515	protein binding	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0008168	methyltransferase activity	IEA		-
GO:0018024	histone-lysine N-methyltransferase activity	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006323	DNA packaging	TAS		10860993
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
GO:0006366	transcription from RNA polymerase II promoter	TAS		10860993
GO:0007267	cell-cell signaling	TAS		10860993
GO:0016568	chromatin modification	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005923	tight junction	TAS	Brain (GO term level: 10)	10860993
GO:0005794	Golgi apparatus	IDA		18029348
GO:0005634	nucleus	TAS		10860993
GO:0005737	cytoplasm	IDA		18029348
GO:0030054	cell junction	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG LYSINE DEGRADATION	44	29	All SZGR 2.0 genes in this pathway
KEGG TIGHT JUNCTION	134	86	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP	380	215	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
MOTAMED RESPONSE TO ANDROGEN DN	6	5	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 6	84	54	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN	411	249	All SZGR 2.0 genes in this pathway
PARK HSC MARKERS	44	31	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL	254	164	All SZGR 2.0 genes in this pathway
BILD SRC ONCOGENIC SIGNATURE	62	38	All SZGR 2.0 genes in this pathway
BILD CTNNB1 ONCOGENIC SIGNATURE	82	52	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR DN	185	116	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP	442	263	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	1470	1476	1A	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-101	1633	1639	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-103/107	2223	2229	m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	2223	2229	m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-129-5p	2020	2026	m8	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	2020	2026	m8	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-133	1388	1394	1A	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	1388	1394	1A	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-137	1342	1349	1A,m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-139	1634	1641	1A,m8	hsa-miR-139^brain	UCUACAGUGCACGUGUCU
miR-141/200a	1856	1862	1A	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	1856	1862	1A	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-142-3p	1932	1938	m8	hsa-miR-142-3p	UGUAGUGUUUCCUACUUUAUGGA
miR-142-3p	1932	1938	m8	hsa-miR-142-3p	UGUAGUGUUUCCUACUUUAUGGA
miR-143	2344	2350	1A	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-144	1125	1131	m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-144	1125	1131	m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-15/16/195/424/497	2224	2231	1A,m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-151	2360	2366	m8	hsa-miR-151^brain	ACUAGACUGAAGCUCCUUGAGG
miR-17-5p/20/93.mr/106/519.d	1781	1787	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-203.1	1410	1416	m8	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-216	1829	1835	1A	hsa-miR-216	UAAUCUCAGCUGGCAACUGUG
miR-219	1998	2005	1A,m8	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-329	1250	1256	1A	hsa-miR-329^brain	AACACACCUGGUUAACCUCUUU
miR-363	2018	2024	1A	hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA
miR-377	2201	2207	m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-448	1180	1186	m8	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-450	2020	2026	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA
miR-503	2225	2231	1A	hsa-miR-503	UAGCAGCGGGAACAGUUCUGCAG
miR-505	1962	1968	1A	hsa-miR-505	GUCAACACUUGCUGGUUUCCUC
miR-543	2006	2012	1A	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-96	1232	1238	m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ASH1L