Gene Page: PTGER3
Summary ?
GeneID | 5733 |
Symbol | PTGER3 |
Synonyms | EP3|EP3-I|EP3-II|EP3-III|EP3-IV|EP3-VI|EP3e|PGE2-R |
Description | prostaglandin E receptor 3 |
Reference | MIM:176806|HGNC:HGNC:9595|Ensembl:ENSG00000050628|HPRD:08906|Vega:OTTHUMG00000009399 |
Gene type | protein-coding |
Map location | 1p31.2 |
Pascal p-value | 0.028 |
Fetal beta | -0.634 |
eGene | Cortex Frontal Cortex BA9 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02692 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004872 | receptor activity | IEA | - | |
GO:0004879 | ligand-dependent nuclear receptor activity | TAS | 10336471 | |
GO:0004957 | prostaglandin E receptor activity | IEA | - | |
GO:0004957 | prostaglandin E receptor activity | NAS | 9073510 | |
GO:0004957 | prostaglandin E receptor activity | TAS | 10947062 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | - | |
GO:0007186 | G-protein coupled receptor protein signaling pathway | TAS | 8307176 | |
GO:0006351 | transcription, DNA-dependent | TAS | 10336471 | |
GO:0008219 | cell death | TAS | 10947062 | |
GO:0007165 | signal transduction | IEA | - | |
GO:0008150 | biological_process | ND | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005635 | nuclear envelope | TAS | 10336471 | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0016021 | integral to membrane | NAS | 9073510 | |
GO:0005886 | plasma membrane | TAS | 10336471 | |
GO:0005887 | integral to plasma membrane | TAS | 8307176 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS | 305 | 177 | All SZGR 2.0 genes in this pathway |
REACTOME EICOSANOID LIGAND BINDING RECEPTORS | 16 | 6 | All SZGR 2.0 genes in this pathway |
REACTOME PROSTANOID LIGAND RECEPTORS | 10 | 5 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA I SIGNALLING EVENTS | 195 | 114 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
GAL LEUKEMIC STEM CELL DN | 244 | 153 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D UP | 182 | 110 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D DN | 142 | 90 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE DN | 54 | 38 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
VANHARANTA UTERINE FIBROID DN | 67 | 45 | All SZGR 2.0 genes in this pathway |
OLSSON E2F3 TARGETS UP | 28 | 14 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL DN | 114 | 58 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
CERVERA SDHB TARGETS 1 UP | 118 | 66 | All SZGR 2.0 genes in this pathway |
FRASOR RESPONSE TO ESTRADIOL UP | 37 | 28 | All SZGR 2.0 genes in this pathway |
OKUMURA INFLAMMATORY RESPONSE LPS | 183 | 115 | All SZGR 2.0 genes in this pathway |
PENG GLUCOSE DEPRIVATION DN | 169 | 112 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
TRAYNOR RETT SYNDROM UP | 45 | 33 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY NO BLOOD DN | 150 | 93 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY DN | 145 | 88 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR UP | 180 | 125 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P2 | 79 | 55 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
ZHENG FOXP3 TARGETS IN T LYMPHOCYTE DN | 37 | 29 | All SZGR 2.0 genes in this pathway |
COATES MACROPHAGE M1 VS M2 UP | 81 | 52 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL A UP | 84 | 52 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
CADWELL ATG16L1 TARGETS UP | 93 | 56 | All SZGR 2.0 genes in this pathway |
YAUCH HEDGEHOG SIGNALING PARACRINE UP | 149 | 85 | All SZGR 2.0 genes in this pathway |
WU SILENCED BY METHYLATION IN BLADDER CANCER | 55 | 42 | All SZGR 2.0 genes in this pathway |
LINDSTEDT DENDRITIC CELL MATURATION D | 68 | 44 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
CROONQUIST NRAS VS STROMAL STIMULATION DN | 99 | 65 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA2 DN | 80 | 51 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 16 | 79 | 47 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 4HR UP | 55 | 41 | All SZGR 2.0 genes in this pathway |
WHITFIELD CELL CYCLE G2 M | 216 | 124 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 4 | 110 | 66 | All SZGR 2.0 genes in this pathway |
YANG BCL3 TARGETS UP | 364 | 236 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-17-5p/20/93.mr/106/519.d | 5019 | 5026 | 1A,m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-182 | 158 | 164 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-186 | 1181 | 1187 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-96 | 157 | 164 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.