Gene Page: PTPN1
Summary ?
GeneID | 5770 |
Symbol | PTPN1 |
Synonyms | PTP1B |
Description | protein tyrosine phosphatase, non-receptor type 1 |
Reference | MIM:176885|HGNC:HGNC:9642|Ensembl:ENSG00000196396|HPRD:01477|Vega:OTTHUMG00000032729 |
Gene type | protein-coding |
Map location | 20q13.1-q13.2 |
Pascal p-value | 0.307 |
Sherlock p-value | 0.778 |
Fetal beta | 0.228 |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0757 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ZNF142 | 0.94 | 0.95 |
ZNF384 | 0.94 | 0.96 |
PFAS | 0.94 | 0.96 |
HCFC1 | 0.94 | 0.94 |
DNMT1 | 0.94 | 0.96 |
ZMIZ1 | 0.94 | 0.95 |
GCN1L1 | 0.94 | 0.95 |
KIAA1267 | 0.94 | 0.95 |
BRPF1 | 0.94 | 0.95 |
SAP130 | 0.94 | 0.96 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.74 | -0.89 |
AF347015.27 | -0.72 | -0.88 |
MT-CO2 | -0.72 | -0.89 |
AF347015.33 | -0.71 | -0.85 |
C5orf53 | -0.70 | -0.77 |
FXYD1 | -0.70 | -0.85 |
COPZ2 | -0.70 | -0.81 |
S100B | -0.70 | -0.84 |
MT-CYB | -0.70 | -0.85 |
AF347015.8 | -0.69 | -0.87 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 11106648 |12907755 |16291744 |17159996 | |
GO:0004725 | protein tyrosine phosphatase activity | TAS | 10748206 | |
GO:0016787 | hydrolase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006470 | protein amino acid dephosphorylation | IEA | - | |
GO:0007165 | signal transduction | TAS | 10748206 | |
GO:0008286 | insulin receptor signaling pathway | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0016020 | membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AKT1 | AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHA | v-akt murine thymoma viral oncogene homolog 1 | - | HPRD | 11579209 |
BCAR1 | CAS | CAS1 | CASS1 | CRKAS | P130Cas | breast cancer anti-estrogen resistance 1 | - | HPRD,BioGRID | 8940134 |
CAV1 | CAV | MSTP085 | VIP21 | caveolin 1, caveolae protein, 22kDa | caveolin-1 interacts with PTP1B. | BIND | 12176037 |
CAV1 | CAV | MSTP085 | VIP21 | caveolin 1, caveolae protein, 22kDa | - | HPRD,BioGRID | 12176037 |
CDH2 | CD325 | CDHN | CDw325 | NCAD | cadherin 2, type 1, N-cadherin (neuronal) | - | HPRD | 12377785 |
CRK | CRKII | v-crk sarcoma virus CT10 oncogene homolog (avian) | Reconstituted Complex | BioGRID | 8940134 |
CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | - | HPRD,BioGRID | 12377785 |
EGFR | ERBB | ERBB1 | HER1 | PIG61 | mENA | epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) | - | HPRD,BioGRID | 7540771 |8621392 |10889023 |12573287 |
GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD | 10660596 |12388170 |
GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | Reconstituted Complex | BioGRID | 8940134 |10660596 |
GSK3B | - | glycogen synthase kinase 3 beta | - | HPRD,BioGRID | 7514173 |
IGF1R | CD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216 | insulin-like growth factor 1 receptor | - | HPRD,BioGRID | 8999839 |
INSR | CD220 | HHF5 | insulin receptor | - | HPRD,BioGRID | 8826975 |
IRS1 | HIRS-1 | insulin receptor substrate 1 | - | HPRD,BioGRID | 10660596 |
JAK2 | JTK10 | Janus kinase 2 (a protein tyrosine kinase) | - | HPRD,BioGRID | 11694501 |
LTK | TYK1 | leukocyte receptor tyrosine kinase | - | HPRD,BioGRID | 12237455 |
NTRK1 | DKFZp781I14186 | MTC | TRK | TRK1 | TRKA | p140-TrkA | neurotrophic tyrosine kinase, receptor, type 1 | - | HPRD,BioGRID | 12237455 |
NTRK2 | GP145-TrkB | TRKB | neurotrophic tyrosine kinase, receptor, type 2 | - | HPRD,BioGRID | 12237455 |
NTRK3 | TRKC | gp145(trkC) | neurotrophic tyrosine kinase, receptor, type 3 | - | HPRD,BioGRID | 12237455 |
PIN1 | DOD | UBL5 | peptidylprolyl cis/trans isomerase, NIMA-interacting 1 | - | HPRD | 9499405 |
RRAS2 | TC21 | related RAS viral (r-ras) oncogene homolog 2 | - | HPRD,BioGRID | 11788587 |
TYK2 | JTK1 | tyrosine kinase 2 | in vivo | BioGRID | 11694501 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ADHERENS JUNCTION | 75 | 53 | All SZGR 2.0 genes in this pathway |
KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
SIG PIP3 SIGNALING IN CARDIAC MYOCTES | 67 | 54 | All SZGR 2.0 genes in this pathway |
SIG INSULIN RECEPTOR PATHWAY IN CARDIAC MYOCYTES | 51 | 41 | All SZGR 2.0 genes in this pathway |
PID INSULIN PATHWAY | 45 | 32 | All SZGR 2.0 genes in this pathway |
PID MET PATHWAY | 80 | 60 | All SZGR 2.0 genes in this pathway |
PID PTP1B PATHWAY | 52 | 40 | All SZGR 2.0 genes in this pathway |
PID NFAT TFPATHWAY | 47 | 39 | All SZGR 2.0 genes in this pathway |
PID TCPTP PATHWAY | 43 | 33 | All SZGR 2.0 genes in this pathway |
PID IGF1 PATHWAY | 30 | 23 | All SZGR 2.0 genes in this pathway |
PID ERBB1 RECEPTOR PROXIMAL PATHWAY | 35 | 29 | All SZGR 2.0 genes in this pathway |
PID AJDISS 2PATHWAY | 48 | 38 | All SZGR 2.0 genes in this pathway |
PID PDGFRB PATHWAY | 129 | 103 | All SZGR 2.0 genes in this pathway |
PID NCADHERIN PATHWAY | 33 | 32 | All SZGR 2.0 genes in this pathway |
REACTOME GROWTH HORMONE RECEPTOR SIGNALING | 24 | 19 | All SZGR 2.0 genes in this pathway |
REACTOME INTEGRIN CELL SURFACE INTERACTIONS | 79 | 48 | All SZGR 2.0 genes in this pathway |
REACTOME INTEGRIN ALPHAIIB BETA3 SIGNALING | 27 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF IFNG SIGNALING | 14 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME INTERFERON GAMMA SIGNALING | 63 | 48 | All SZGR 2.0 genes in this pathway |
REACTOME INTERFERON ALPHA BETA SIGNALING | 64 | 50 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF IFNA SIGNALING | 24 | 22 | All SZGR 2.0 genes in this pathway |
REACTOME INTERFERON SIGNALING | 159 | 116 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET AGGREGATION PLUG FORMATION | 36 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION | 208 | 138 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
CHIN BREAST CANCER COPY NUMBER UP | 27 | 18 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE UP | 134 | 93 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
COLLIS PRKDC REGULATORS | 15 | 10 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 20Q12 Q13 AMPLICON | 149 | 76 | All SZGR 2.0 genes in this pathway |
ZUCCHI METASTASIS UP | 43 | 24 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST DN | 309 | 206 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE DN | 245 | 154 | All SZGR 2.0 genes in this pathway |
GUO HEX TARGETS UP | 81 | 54 | All SZGR 2.0 genes in this pathway |
ABBUD LIF SIGNALING 1 UP | 46 | 29 | All SZGR 2.0 genes in this pathway |
FAELT B CLL WITH VH3 21 UP | 44 | 30 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D7 | 40 | 21 | All SZGR 2.0 genes in this pathway |
GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
WELCSH BRCA1 TARGETS UP | 198 | 132 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
ICHIBA GRAFT VERSUS HOST DISEASE D7 UP | 107 | 67 | All SZGR 2.0 genes in this pathway |
ICHIBA GRAFT VERSUS HOST DISEASE 35D UP | 131 | 79 | All SZGR 2.0 genes in this pathway |
LINDSTEDT DENDRITIC CELL MATURATION C | 69 | 49 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
DANG MYC TARGETS DN | 31 | 25 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
SENGUPTA EBNA1 ANTICORRELATED | 173 | 85 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO GONADOTROPHINS DN | 87 | 66 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO FORSKOLIN DN | 88 | 68 | All SZGR 2.0 genes in this pathway |
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP | 134 | 85 | All SZGR 2.0 genes in this pathway |
VANOEVELEN MYOGENESIS SIN3A TARGETS | 220 | 133 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 1069 | 1076 | 1A,m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-124.1 | 1764 | 1771 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 1764 | 1770 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-22 | 1426 | 1432 | m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
miR-299-5p | 1819 | 1825 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.