SZGR2

Summary ?

GeneID	5979
Symbol	RET
Synonyms	CDHF12\|CDHR16\|HSCR1\|MEN2A\|MEN2B\|MTC1\|PTC\|RET-ELE1\|RET51
Description	ret proto-oncogene
Reference	MIM:164761\|HGNC:HGNC:9967\|Ensembl:ENSG00000165731\|HPRD:01266\|Vega:OTTHUMG00000018024
Gene type	protein-coding
Map location	10q11.2
Pascal p-value	0.807
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 4

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg06559368	10	43573319	RET	3.92E-9	-0.022	2.44E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs7370564		0	RET	5979		0.17		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
KDM2A	0.61	0.65
GON4L	0.61	0.65
UBR4	0.61	0.65
CABLES2	0.60	0.65
AGPAT6	0.60	0.64
XXbac-B461K10.1	0.60	0.66
MAP3K3	0.60	0.65
TNRC6A	0.60	0.64
TNRC6C	0.60	0.65
DIDO1	0.60	0.64

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.48	-0.55
MT-CO2	-0.46	-0.53
IFI27	-0.46	-0.55
HIGD1B	-0.45	-0.56
B2M	-0.45	-0.53
AC021016.1	-0.45	-0.56
AF347015.27	-0.45	-0.52
AF347015.21	-0.44	-0.61
COPZ2	-0.44	-0.52
C5orf53	-0.44	-0.48

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004714	transmembrane receptor protein tyrosine kinase activity	IEA	neurite (GO term level: 8)	-
GO:0000166	nucleotide binding	IEA		-
GO:0004872	receptor activity	IEA		-
GO:0004872	receptor activity	TAS		7824936
GO:0005509	calcium ion binding	IEA		-
GO:0005515	protein binding	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0005524	ATP binding	NAS		-
GO:0004713	protein tyrosine kinase activity	NAS		-
GO:0016740	transferase activity	IEA		-
GO:0016301	kinase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0042551	neuron maturation	IEA	neuron (GO term level: 10)	-
GO:0048484	enteric nervous system development	IEA	neuron (GO term level: 7)	-
GO:0007399	nervous system development	IEA	neurite (GO term level: 5)	-
GO:0000165	MAPKKK cascade	IEA		-
GO:0001755	neural crest cell migration	IEA		-
GO:0001657	ureteric bud development	IEA		-
GO:0001838	embryonic epithelial tube formation	IEA		-
GO:0007156	homophilic cell adhesion	IEA		-
GO:0006468	protein amino acid phosphorylation	NAS		-
GO:0006468	protein amino acid phosphorylation	TAS		7824936
GO:0007165	signal transduction	TAS		7824936
GO:0007497	posterior midgut development	TAS		8114939
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005794	Golgi apparatus	IDA		18029348
GO:0005737	cytoplasm	IDA		18029348
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	IDA		18029348

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	-	HPRD	12727845
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	Reconstituted Complex	BioGRID	9393871
DOK1	MGC117395 \| MGC138860 \| P62DOK	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	-	HPRD,BioGRID	12087092
DOK2	p56DOK \| p56dok-2	docking protein 2, 56kDa	-	HPRD,BioGRID	11470823
DOK3	DOKL \| FLJ22570 \| FLJ39939	docking protein 3	-	HPRD	11470823
DOK4	FLJ10488	docking protein 4	-	HPRD,BioGRID	11470823
DOK5	C20orf180 \| MGC16926	docking protein 5	-	HPRD,BioGRID	11470823
DOK6	DOK5L \| HsT3226 \| MGC20785	docking protein 6	-	HPRD,BioGRID	15286081
FRS2	FRS2A \| FRS2alpha \| SNT \| SNT-1 \| SNT1	fibroblast growth factor receptor substrate 2	RET interacts with FRS2	BIND	11390647
FRS2	FRS2A \| FRS2alpha \| SNT \| SNT-1 \| SNT1	fibroblast growth factor receptor substrate 2	-	HPRD,BioGRID	11360177
GAB1	-	GRB2-associated binding protein 1	-	HPRD	11360177
GDNF	ATF1 \| ATF2 \| HFB1-GDNF	glial cell derived neurotrophic factor	-	HPRD	8674117 \|9482105
GFRA1	GDNFR \| GDNFRA \| GFR-ALPHA-1 \| MGC23045 \| RET1L \| RETL1 \| TRNR1	GDNF family receptor alpha 1	-	HPRD	9740802 \|10829012
GFRA1	GDNFR \| GDNFRA \| GFR-ALPHA-1 \| MGC23045 \| RET1L \| RETL1 \| TRNR1	GDNF family receptor alpha 1	Reconstituted Complex	BioGRID	9192898 \|10829012
GOLGA5	GOLIM5 \| RFG5 \| ret-II	golgi autoantigen, golgin subfamily a, 5	-	HPRD	2734021 \|9915833
GRB10	GRB-IR \| Grb-10 \| IRBP \| KIAA0207 \| MEG1 \| RSS	growth factor receptor-bound protein 10	-	HPRD,BioGRID	7665556
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD	9393871
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	Reconstituted Complex	BioGRID	7665556 \|8183561
GRB7	-	growth factor receptor-bound protein 7	-	HPRD,BioGRID	8631863
NRTN	NTN	neurturin	-	HPRD,BioGRID	9192898
PDLIM7	LMP1	PDZ and LIM domain 7 (enigma)	-	HPRD,BioGRID	12176011
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	-	HPRD	10652352
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	RET9 phosphorylates PLC-gamma via its amino-terminal SH2 domain. This interaction was modelled on a demonstrated interaction between RET9 from human and PLC-gamma from cow.	BIND	9047383
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	-	HPRD,BioGRID	8628282
PTPRF	FLJ43335 \| FLJ45062 \| FLJ45567 \| LAR	protein tyrosine phosphatase, receptor type, F	-	HPRD,BioGRID	11121408
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	RET9 phosphorylates Shc.	BIND	9047383
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD,BioGRID	8183561 \|9047384
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	-	HPRD,BioGRID	10070972
STAT3	APRF \| FLJ20882 \| HIES \| MGC16063	signal transducer and activator of transcription 3 (acute-phase response factor)	-	HPRD,BioGRID	11536047 \|12637586 \|15485908

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ENDOCYTOSIS	183	132	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG THYROID CANCER	29	26	All SZGR 2.0 genes in this pathway
PID RET PATHWAY	39	29	All SZGR 2.0 genes in this pathway
PID AJDISS 2PATHWAY	48	38	All SZGR 2.0 genes in this pathway
NAKAMURA CANCER MICROENVIRONMENT UP	26	14	All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN	493	298	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP	408	247	All SZGR 2.0 genes in this pathway
TURASHVILI BREAST DUCTAL CARCINOMA VS DUCTAL NORMAL UP	44	25	All SZGR 2.0 genes in this pathway
TURASHVILI BREAST DUCTAL CARCINOMA VS LOBULAR NORMAL UP	73	50	All SZGR 2.0 genes in this pathway
DOANE BREAST CANCER ESR1 UP	112	72	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP	372	227	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR DN	129	84	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA DN	146	94	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA BY DMOG DN	59	40	All SZGR 2.0 genes in this pathway
ELVIDGE HIF2A TARGETS UP	6	5	All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A AND HIF2A TARGETS UP	41	22	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS	205	145	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL DN	114	58	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 2 DN	51	42	All SZGR 2.0 genes in this pathway
INGRAM SHH TARGETS DN	64	41	All SZGR 2.0 genes in this pathway
HASEGAWA TUMORIGENESIS BY RET C634R	11	7	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
FRASOR RESPONSE TO ESTRADIOL UP	37	28	All SZGR 2.0 genes in this pathway
STOSSI RESPONSE TO ESTRADIOL	50	35	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP	240	152	All SZGR 2.0 genes in this pathway
LEE AGING NEOCORTEX DN	80	49	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR UP	180	125	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE UP	66	44	All SZGR 2.0 genes in this pathway
FINETTI BREAST CANCERS KINOME BLUE	21	16	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN UP	181	112	All SZGR 2.0 genes in this pathway
OSADA ASCL1 TARGETS UP	46	30	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BRAIN DN	85	58	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B UP	172	109	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
CONRAD STEM CELL	39	27	All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP	149	85	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 16	26	17	All SZGR 2.0 genes in this pathway
VALK AML WITH 11Q23 REARRANGED	22	13	All SZGR 2.0 genes in this pathway
POOLA INVASIVE BREAST CANCER UP	288	168	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3	349	234	All SZGR 2.0 genes in this pathway
STEIN ESR1 TARGETS	85	55	All SZGR 2.0 genes in this pathway
STEIN ESTROGEN RESPONSE NOT VIA ESRRA	18	12	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA3 UP	80	54	All SZGR 2.0 genes in this pathway
NAKAYAMA SOFT TISSUE TUMORS PCA1 DN	74	47	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3	210	148	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR UP	61	44	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP	229	149	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR UP	324	193	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 UP	211	131	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP	281	183	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE	227	151	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	1161	1167	m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	1161	1167	m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-128	1595	1602	1A,m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	1595	1602	1A,m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-15/16/195/424/497	1162	1169	1A,m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-218	666	672	1A	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-218	666	672	1A	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-27	1596	1602	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	1596	1602	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-377	1116	1123	1A,m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-503	1163	1169	1A	hsa-miR-503	UAGCAGCGGGAACAGUUCUGCAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RET