SZGR2

Summary ?

GeneID	598
Symbol	BCL2L1
Synonyms	BCL-XL/S\|BCL2L\|BCLX\|Bcl-X\|PPP1R52
Description	BCL2 like 1
Reference	MIM:600039\|HGNC:HGNC:992\|Ensembl:ENSG00000171552\|HPRD:02497\|Vega:OTTHUMG00000032192
Gene type	protein-coding
Map location	20q11.21
Pascal p-value	0.81
Sherlock p-value	0.98
Fetal beta	-0.307

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0455

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0042802	identical protein binding	IPI		15131699
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0043524	negative regulation of neuron apoptosis	IEA	neuron (GO term level: 9)	-
GO:0001836	release of cytochrome c from mitochondria	IDA		9843949
GO:0008634	negative regulation of survival gene product expression	TAS		8358789
GO:0009314	response to radiation	IEA		-
GO:0042981	regulation of apoptosis	IEA		-
GO:0045768	positive regulation of anti-apoptosis	IEA		-
GO:0046902	regulation of mitochondrial membrane permeability	IDA		9843949
GO:0051881	regulation of mitochondrial membrane potential	IDA		9843949
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005739	mitochondrion	IDA		12011449
GO:0005739	mitochondrion	IEA		-
GO:0005741	mitochondrial outer membrane	EXP		9727492 \|10195903 \|10198631 \|11463392
GO:0005741	mitochondrial outer membrane	NAS		12667443
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0031965	nuclear membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ANTXR1	ATR \| FLJ10601 \| FLJ11298 \| FLJ21776 \| TEM8	anthrax toxin receptor 1	-	HPRD	11574549
APAF1	CED4 \| DKFZp781B1145	apoptotic peptidase activating factor 1	-	HPRD,BioGRID	9488720 \|9539746
AVEN	PDCD12	apoptosis, caspase activation inhibitor	-	HPRD,BioGRID	10949025
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	-	HPRD	7834748 \|9305851 \|9388232 \|11483855 \|11494146 \|11583631
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	Bcl-XL interacts with Bad. This interaction was modelled on a demonstrated interaction between Bcl-XL from an unspecified species and human Bad.	BIND	15721256
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	Affinity Capture-Western Protein-peptide Reconstituted Complex Two-hybrid	BioGRID	7834748 \|9824152 \|10620799 \|11206074 \|11494146 \|12115603 \|12137781 \|15694340 \|15705582
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	Bad interacts with Bcl-XL.	BIND	15694340
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	-	HPRD	7834748 \|11494146\|11206074
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	Bad interacts with Bcl-xL.	BIND	15574335
BAG1	RAP46	BCL2-associated athanogene	-	HPRD	10467399
BAK1	BAK \| BAK-LIKE \| BCL2L7 \| CDN1 \| MGC117255 \| MGC3887	BCL2-antagonist/killer 1	-	HPRD,BioGRID	11175750
BAX	BCL2L4	BCL2-associated X protein	Bax interacts with Bcl-XL via its BH3 domain. This interaction was modeled on a demonstrated interaction between mouse Bax and human Bcl-XL.	BIND	11060313
BAX	BCL2L4	BCL2-associated X protein	Bax interacts with Bcl-XL.	BIND	9372935
BAX	BCL2L4	BCL2-associated X protein	Bax interacts with Bcl-xL.	BIND	15574335
BAX	BCL2L4	BCL2-associated X protein	Affinity Capture-Western Protein-peptide	BioGRID	9824152 \|12137781 \|12853473
BBC3	JFY1 \| PUMA	BCL2 binding component 3	PUMA interacts with Bcl-xL.	BIND	15574335
BBC3	JFY1 \| PUMA	BCL2 binding component 3	Puma interacts with Bcl-XL.	BIND	15694340
BBC3	JFY1 \| PUMA	BCL2 binding component 3	Affinity Capture-Western	BioGRID	15694340
BBC3	JFY1 \| PUMA	BCL2 binding component 3	Bcl-XL interacts with Puma. This interaction was modelled on a demonstrated interaction between Bcl-XL from an unspecified species and human Puma.	BIND	15721256
BCAP31	6C6-AG \| BAP31 \| CDM \| DXS1357E	B-cell receptor-associated protein 31	-	HPRD,BioGRID	9334338
BCL2	Bcl-2	B-cell CLL/lymphoma 2	-	HPRD	11583631
BCL2	Bcl-2	B-cell CLL/lymphoma 2	Affinity Capture-Western Protein-peptide	BioGRID	12137781 \|14980220
BCL2L10	BCL-B \| Boo \| Diva \| MGC129810 \| MGC129811	BCL2-like 10 (apoptosis facilitator)	-	HPRD	11278245
BCL2L11	BAM \| BIM \| BIM-alpha6 \| BIM-beta6 \| BIM-beta7 \| BOD \| BimEL \| BimL	BCL2-like 11 (apoptosis facilitator)	-	HPRD	9430630 \|10198631 \|11859372\|11859372
BCL2L11	BAM \| BIM \| BIM-alpha6 \| BIM-beta6 \| BIM-beta7 \| BOD \| BimEL \| BimL	BCL2-like 11 (apoptosis facilitator)	Bim interacts with Bcl-XL.	BIND	15694340
BCL2L11	BAM \| BIM \| BIM-alpha6 \| BIM-beta6 \| BIM-beta7 \| BOD \| BimEL \| BimL	BCL2-like 11 (apoptosis facilitator)	Affinity Capture-Western FRET	BioGRID	14596824 \|15694340
BCL2L11	BAM \| BIM \| BIM-alpha6 \| BIM-beta6 \| BIM-beta7 \| BOD \| BimEL \| BimL	BCL2-like 11 (apoptosis facilitator)	-	HPRD	11859372
BCL2L11	BAM \| BIM \| BIM-alpha6 \| BIM-beta6 \| BIM-beta7 \| BOD \| BimEL \| BimL	BCL2-like 11 (apoptosis facilitator)	Bcl-XL interacts with Bim. This interaction was modelled on a demonstrated interaction between Bcl-XL from an unspecified species and human Bim.	BIND	15721256
BCL2L14	BCLG	BCL2-like 14 (apoptosis facilitator)	-	HPRD,BioGRID	11054413
BCLAF1	BTF \| KIAA0164 \| bK211L9.1	BCL2-associated transcription factor 1	-	HPRD	10330179
BECN1	ATG6 \| VPS30 \| beclin1	beclin 1, autophagy related	-	HPRD,BioGRID	9765397
BID	FP497 \| MGC15319 \| MGC42355	BH3 interacting domain death agonist	Bid interacts with Bcl-XL.	BIND	15694340
BID	FP497 \| MGC15319 \| MGC42355	BH3 interacting domain death agonist	Protein-peptide	BioGRID	15694340
BID	FP497 \| MGC15319 \| MGC42355	BH3 interacting domain death agonist	BCL-XL interacts with the alpha-helical region of the BID-EL BH3 death domain.	BIND	15353804
BID	FP497 \| MGC15319 \| MGC42355	BH3 interacting domain death agonist	BCL-XL interacts with the alpha-helical region of the BID BH3 death domain.	BIND	15353804
BID	FP497 \| MGC15319 \| MGC42355	BH3 interacting domain death agonist	Bcl-XL interacts with Bid. This interaction was modelled on a demonstrated interaction between Bcl-XL from an unspecified species and human Bid.	BIND	15721256
BID	FP497 \| MGC15319 \| MGC42355	BH3 interacting domain death agonist	Bid interacts with Bcl-xL.	BIND	15574335
BIK	BIP1 \| BP4 \| NBK	BCL2-interacting killer (apoptosis-inducing)	Bik interacts with Bcl-XL.	BIND	15694340
BIK	BIP1 \| BP4 \| NBK	BCL2-interacting killer (apoptosis-inducing)	-	HPRD	9525867 \|11342619 \|12853473\|11342619 \|12853473
BIK	BIP1 \| BP4 \| NBK	BCL2-interacting killer (apoptosis-inducing)	Bcl-XL interacts with Bik. This interaction was modelled on a demonstrated interaction between Bcl-XL from an unspecified species and human Bik.	BIND	15721256
BIK	BIP1 \| BP4 \| NBK	BCL2-interacting killer (apoptosis-inducing)	-	HPRD,BioGRID	11342619 \|12853473
BLK	MGC10442	B lymphoid tyrosine kinase	Reconstituted Complex	BioGRID	9525867
BMF	FLJ00065	Bcl2 modifying factor	Bmf interacts with Bcl-XL. This interaction was modelled on a demonstrated interaction between mouse Bmf and human Bcl-XL.	BIND	15694340
BMF	FLJ00065	Bcl2 modifying factor	Bcl-XL interacts with Bmf. This interaction was modelled on a demonstrated interaction between Bcl-XL from an unspecified species and human Bmf.	BIND	15721256
BNIP1	NIP1 \| SEC20 \| TRG-8	BCL2/adenovirus E1B 19kDa interacting protein 1	-	HPRD,BioGRID	10217402
BNIP3	NIP3	BCL2/adenovirus E1B 19kDa interacting protein 3	-	HPRD,BioGRID	10625696
BNIP3L	BNIP3a \| NIX	BCL2/adenovirus E1B 19kDa interacting protein 3-like	-	HPRD,BioGRID	9973195 \|10467396\|10467396
BNIPL	BNIP-S \| BNIPL-1 \| BNIPL-2 \| BNIPL1 \| BNIPL2 \| PP753	BCL2/adenovirus E1B 19kD interacting protein like	Reconstituted Complex Two-hybrid	BioGRID	9973195 \|12901880
CASP2	CASP-2 \| ICH-1L \| ICH-1L/1S \| ICH1 \| NEDD2	caspase 2, apoptosis-related cysteine peptidase	Phenotypic Suppression	BioGRID	11832478
CASP8	ALPS2B \| CAP4 \| FLICE \| FLJ17672 \| MACH \| MCH5 \| MGC78473	caspase 8, apoptosis-related cysteine peptidase	-	HPRD	11733517
CASP8	ALPS2B \| CAP4 \| FLICE \| FLJ17672 \| MACH \| MCH5 \| MGC78473	caspase 8, apoptosis-related cysteine peptidase	Phenotypic Suppression	BioGRID	11832478
CASP9	APAF-3 \| APAF3 \| CASPASE-9c \| ICE-LAP6 \| MCH6	caspase 9, apoptosis-related cysteine peptidase	-	HPRD,BioGRID	9539746
CFLAR	CASH \| CASP8AP1 \| CLARP \| Casper \| FLAME \| FLAME-1 \| FLAME1 \| FLIP \| I-FLICE \| MRIT \| c-FLIP \| c-FLIPL \| c-FLIPR \| c-FLIPS	CASP8 and FADD-like apoptosis regulator	-	HPRD,BioGRID	9326610
CFLAR	CASH \| CASP8AP1 \| CLARP \| Casper \| FLAME \| FLAME-1 \| FLAME1 \| FLIP \| I-FLICE \| MRIT \| c-FLIP \| c-FLIPL \| c-FLIPR \| c-FLIPS	CASP8 and FADD-like apoptosis regulator	MRIT-alpha-1 interacts with BclXL. This interaction was modelled on a demonstrated interaction between human MRIT-alpha-1 and BclXL from an unspecified species.	BIND	9326610
CRYAA	CRYA1 \| HSPB4	crystallin, alpha A	HalphaA-crystallin interacts with Bcl-Xs.	BIND	14752512
CRYAB	CRYA2 \| CTPP2 \| HSPB5	crystallin, alpha B	HalphaB-crystallin interacts with Bcl-Xs.	BIND	14752512
CYCS	CYC \| HCS	cytochrome c, somatic	-	HPRD,BioGRID	9192670
DYNLL1	DLC1 \| DLC8 \| DNCL1 \| DNCLC1 \| LC8 \| LC8a \| MGC126137 \| MGC126138 \| PIN \| hdlc1	dynein, light chain, LC8-type 1	Affinity Capture-Western	BioGRID	10198631
FKBP8	FKBP38 \| FKBPr38	FK506 binding protein 8, 38kDa	-	HPRD,BioGRID	12510191
HRK	DP5 \| HARAKIRI	harakiri, BCL2 interacting protein (contains only BH3 domain)	-	HPRD	9130713\|10075695
HRK	DP5 \| HARAKIRI	harakiri, BCL2 interacting protein (contains only BH3 domain)	Hrk interacts with Bcl-XL.	BIND	15694340
HRK	DP5 \| HARAKIRI	harakiri, BCL2 interacting protein (contains only BH3 domain)	Bcl-XL interacts with Hrk. This interaction was modelled on a demonstrated interaction between Bcl-XL from an unspecified species and human Hrk.	BIND	15721256
HRK	DP5 \| HARAKIRI	harakiri, BCL2 interacting protein (contains only BH3 domain)	Hrk interacts with Bcl-XL.	BIND	9130713
HRK	DP5 \| HARAKIRI	harakiri, BCL2 interacting protein (contains only BH3 domain)	-	HPRD,BioGRID	9130713 \|10075695
IKZF3	AIO \| AIOLOS \| ZNFN1A3	IKAROS family zinc finger 3 (Aiolos)	-	HPRD,BioGRID	11714801
IRS1	HIRS-1	insulin receptor substrate 1	-	HPRD,BioGRID	10679027
IRS2	-	insulin receptor substrate 2	-	HPRD	10679027
MCL1	BCL2L3 \| EAT \| MCL1L \| MCL1S \| MGC104264 \| MGC1839 \| TM	myeloid cell leukemia sequence 1 (BCL2-related)	Affinity Capture-Western	BioGRID	10837489
MOAP1	MAP-1 \| PNMA4	modulator of apoptosis 1	MAP-1 interacts with Bcl-XL via its amino and carboxy terminal regions.	BIND	11060313
MOAP1	MAP-1 \| PNMA4	modulator of apoptosis 1	-	HPRD,BioGRID	11060313
PMAIP1	APR \| NOXA	phorbol-12-myristate-13-acetate-induced protein 1	-	HPRD,BioGRID	10807576
PPP1CA	MGC15877 \| MGC1674 \| PP-1A \| PPP1A	protein phosphatase 1, catalytic subunit, alpha isoform	-	HPRD,BioGRID	12115603
PSEN1	AD3 \| FAD \| PS1 \| S182	presenilin 1	-	HPRD,BioGRID	10446169
PSEN2	AD3L \| AD4 \| PS2 \| STM2	presenilin 2 (Alzheimer disease 4)	-	HPRD,BioGRID	10446169
RAD9A	RAD9	RAD9 homolog A (S. pombe)	Affinity Capture-Western Two-hybrid	BioGRID	10620799 \|16189514
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	Reconstituted Complex	BioGRID	8929532
RTN1	MGC133250 \| NSP	reticulon 1	NSP-C interacts with Bcl-XL.	BIND	11126360
RTN1	MGC133250 \| NSP	reticulon 1	-	HPRD,BioGRID	11126360
RTN4	ASY \| NI220/250 \| NOGO \| NOGO-A \| NOGOC \| NSP \| NSP-CL \| Nbla00271 \| Nbla10545 \| Nogo-B \| Nogo-C \| RTN-X \| RTN4-A \| RTN4-B1 \| RTN4-B2 \| RTN4-C	reticulon 4	-	HPRD,BioGRID	11126360
RTN4	ASY \| NI220/250 \| NOGO \| NOGO-A \| NOGOC \| NSP \| NSP-CL \| Nbla00271 \| Nbla10545 \| Nogo-B \| Nogo-C \| RTN-X \| RTN4-A \| RTN4-B1 \| RTN4-B2 \| RTN4-C	reticulon 4	RTN-XS interacts with Bcl-XL.	BIND	11126360
SIVA1	CD27BP \| SIVA \| Siva-1 \| Siva-2	SIVA1, apoptosis-inducing factor	-	HPRD	12011449
SNCA	MGC110988 \| NACP \| PARK1 \| PARK4 \| PD1	synuclein, alpha (non A4 component of amyloid precursor)	-	HPRD	11742726
SPNS1	FLJ38358 \| HSpin1 \| LAT \| PP2030 \| SPIN1 \| SPINL \| nrs	spinster homolog 1 (Drosophila)	-	HPRD,BioGRID	12815463
TMBIM6	BAXI1 \| BI-1 \| TEGT	transmembrane BAX inhibitor motif containing 6	-	HPRD	9660918
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	Bcl-xl interacts with p53.	BIND	14963330
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD	12667443
TPT1	FLJ27337 \| HRF \| TCTP \| p02	tumor protein, translationally-controlled 1	Bcl-xL interacts with TCTP.	BIND	15870695
VDAC1	MGC111064 \| PORIN \| PORIN-31-HL	voltage-dependent anion channel 1	Affinity Capture-Western Reconstituted Complex	BioGRID	10365962 \|10737788 \|12767928 \|15637055
VDAC1	MGC111064 \| PORIN \| PORIN-31-HL	voltage-dependent anion channel 1	-	HPRD	10049775 \|10365962 \|10737788

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG APOPTOSIS	88	62	All SZGR 2.0 genes in this pathway
KEGG JAK STAT SIGNALING PATHWAY	155	105	All SZGR 2.0 genes in this pathway
KEGG AMYOTROPHIC LATERAL SCLEROSIS ALS	53	43	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG PANCREATIC CANCER	70	56	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
KEGG SMALL CELL LUNG CANCER	84	67	All SZGR 2.0 genes in this pathway
BIOCARTA CHEMICAL PATHWAY	22	15	All SZGR 2.0 genes in this pathway
BIOCARTA IL2RB PATHWAY	38	26	All SZGR 2.0 genes in this pathway
BIOCARTA RAS PATHWAY	23	20	All SZGR 2.0 genes in this pathway
BIOCARTA BAD PATHWAY	26	23	All SZGR 2.0 genes in this pathway
BIOCARTA MITOCHONDRIA PATHWAY	21	15	All SZGR 2.0 genes in this pathway
SIG PIP3 SIGNALING IN CARDIAC MYOCTES	67	54	All SZGR 2.0 genes in this pathway
SA PROGRAMMED CELL DEATH	12	9	All SZGR 2.0 genes in this pathway
PID IL4 2PATHWAY	65	43	All SZGR 2.0 genes in this pathway
PID CD40 PATHWAY	31	26	All SZGR 2.0 genes in this pathway
PID NFAT 3PATHWAY	54	47	All SZGR 2.0 genes in this pathway
PID IL2 PI3K PATHWAY	34	27	All SZGR 2.0 genes in this pathway
PID P53 DOWNSTREAM PATHWAY	137	94	All SZGR 2.0 genes in this pathway
PID ERBB1 DOWNSTREAM PATHWAY	105	78	All SZGR 2.0 genes in this pathway
PID ATF2 PATHWAY	59	43	All SZGR 2.0 genes in this pathway
PID IL3 PATHWAY	27	19	All SZGR 2.0 genes in this pathway
PID IL6 7 PATHWAY	47	40	All SZGR 2.0 genes in this pathway
PID EPO PATHWAY	34	29	All SZGR 2.0 genes in this pathway
PID IL2 STAT5 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID PI3KCI AKT PATHWAY	35	30	All SZGR 2.0 genes in this pathway
REACTOME APOPTOSIS	148	94	All SZGR 2.0 genes in this pathway
REACTOME INNATE IMMUNE SYSTEM	279	178	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME INFLAMMASOMES	17	12	All SZGR 2.0 genes in this pathway
REACTOME NUCLEOTIDE BINDING DOMAIN LEUCINE RICH REPEAT CONTAINING RECEPTOR NLR SIGNALING PATHWAYS	46	33	All SZGR 2.0 genes in this pathway
REACTOME INTRINSIC PATHWAY FOR APOPTOSIS	30	21	All SZGR 2.0 genes in this pathway
PUIFFE INVASION INHIBITED BY ASCITES UP	82	51	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
GRABARCZYK BCL11B TARGETS DN	57	35	All SZGR 2.0 genes in this pathway
NOJIMA SFRP2 TARGETS DN	25	18	All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP	269	146	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP	238	144	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP	544	308	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP	431	237	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN	459	276	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP	722	443	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP	293	179	All SZGR 2.0 genes in this pathway
LAU APOPTOSIS CDKN2A UP	55	40	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 UP	329	196	All SZGR 2.0 genes in this pathway
BEGUM TARGETS OF PAX3 FOXO1 FUSION DN	45	34	All SZGR 2.0 genes in this pathway
RAMJAUN APOPTOSIS BY TGFB1 VIA SMAD4 DN	8	6	All SZGR 2.0 genes in this pathway
MARKS HDAC TARGETS DN	15	11	All SZGR 2.0 genes in this pathway
GALLUZZI PERMEABILIZE MITOCHONDRIA	43	31	All SZGR 2.0 genes in this pathway
DUTTA APOPTOSIS VIA NFKB	33	25	All SZGR 2.0 genes in this pathway
GALLUZZI PREVENT MITOCHONDIAL PERMEABILIZATION	22	16	All SZGR 2.0 genes in this pathway
SHANK TAL1 TARGETS DN	10	6	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN	637	377	All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN	261	155	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP	487	286	All SZGR 2.0 genes in this pathway
SCHAEFFER SOX9 TARGETS IN PROSTATE DEVELOPMENT UP	21	19	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 480 HELA	164	118	All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 240 MCF10A	57	36	All SZGR 2.0 genes in this pathway
PENG LEUCINE DEPRIVATION DN	187	122	All SZGR 2.0 genes in this pathway
MOOTHA VOXPHOS	87	51	All SZGR 2.0 genes in this pathway
NEMETH INFLAMMATORY RESPONSE LPS UP	88	64	All SZGR 2.0 genes in this pathway
KANG IMMORTALIZED BY TERT UP	89	61	All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS UP	214	133	All SZGR 2.0 genes in this pathway
WU HBX TARGETS 1 DN	23	14	All SZGR 2.0 genes in this pathway
MARIADASON REGULATED BY HISTONE ACETYLATION UP	83	49	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY HNE AND TBH	60	42	All SZGR 2.0 genes in this pathway
VARELA ZMPSTE24 TARGETS UP	40	30	All SZGR 2.0 genes in this pathway
WU HBX TARGETS 2 UP	23	13	All SZGR 2.0 genes in this pathway
MARTINEZ RESPONSE TO TRABECTEDIN DN	271	175	All SZGR 2.0 genes in this pathway
SANSOM APC MYC TARGETS	217	138	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS DN	292	189	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION DN	281	179	All SZGR 2.0 genes in this pathway
MARZEC IL2 SIGNALING UP	115	80	All SZGR 2.0 genes in this pathway
MATZUK SPERMATOCYTE	72	55	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP	245	159	All SZGR 2.0 genes in this pathway
WINTER HYPOXIA METAGENE	242	168	All SZGR 2.0 genes in this pathway
MOOTHA HUMAN MITODB 6 2002	429	260	All SZGR 2.0 genes in this pathway
MOOTHA MITOCHONDRIA	447	277	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D CLUSTER DN	40	26	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D UP	139	95	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 DN	45	30	All SZGR 2.0 genes in this pathway
HIRSCH CELLULAR TRANSFORMATION SIGNATURE UP	242	159	All SZGR 2.0 genes in this pathway
QI HYPOXIA TARGETS OF HIF1A AND FOXA2	37	27	All SZGR 2.0 genes in this pathway
ACOSTA PROLIFERATION INDEPENDENT MYC TARGETS DN	116	74	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 DN	88	61	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 DN	82	51	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 UP	140	94	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP	259	159	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
BOSCO ALLERGEN INDUCED TH2 ASSOCIATED MODULE	151	86	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	945	952	1A,m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-133	764	771	1A,m8	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	764	771	1A,m8	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-142-3p	88	94	1A	hsa-miR-142-3p	UGUAGUGUUUCCUACUUUAUGGA
miR-326	791	797	m8	hsa-miR-326	CCUCUGGGCCCUUCCUCCAG
miR-377	1441	1448	1A,m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-491	187	193	1A	hsa-miR-491^brain	AGUGGGGAACCCUUCCAUGAGGA
miR-495	1233	1239	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: BCL2L1