SZGR2

Summary ?

GeneID	66008
Symbol	TRAK2
Synonyms	ALS2CR3\|CALS-C\|GRIF-1\|GRIF1\|MILT2\|OIP98
Description	trafficking protein, kinesin binding 2
Reference	MIM:607334\|HGNC:HGNC:13206\|Ensembl:ENSG00000115993\|HPRD:09547\|Vega:OTTHUMG00000132822
Gene type	protein-coding
Map location	2q33
Pascal p-value	0.478
Sherlock p-value	0.645
Fetal beta	0.069
eGene	Myers' cis & trans
Support	CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.02

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs10877185	chr12	59297985	TRAK2	66008		0.12		trans
rs2267312	chr22	34288043	TRAK2	66008		0.09		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0050811	GABA receptor binding	NAS	GABA (GO term level: 5)	15644324
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005737	cytoplasm	ISS		12034717
GO:0005886	plasma membrane	ISS		12034717

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PUIFFE INVASION INHIBITED BY ASCITES DN	145	91	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
RODRIGUES DCC TARGETS DN	121	84	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP	404	246	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED UP	78	48	All SZGR 2.0 genes in this pathway
PAPASPYRIDONOS UNSTABLE ATEROSCLEROTIC PLAQUE UP	52	36	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN UP	177	113	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES CD4 DN	116	71	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL	330	217	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
PETRETTO HEART MASS QTL CIS UP	28	15	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 UP	256	159	All SZGR 2.0 genes in this pathway
ALCALAY AML BY NPM1 LOCALIZATION DN	184	132	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS MATURE CELL	293	160	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS UP	388	234	All SZGR 2.0 genes in this pathway
MOOTHA PGC	420	269	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS UP	74	45	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 8	26	17	All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS	535	325	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
NIELSEN LEIOMYOSARCOMA DN	18	11	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP	397	206	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS DN	242	146	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-129-5p	717	723	1A	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	717	723	1A	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-148/152	53	60	1A,m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-153	1004	1010	m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-181	112	118	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-19	1036	1043	1A,m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	1036	1043	1A,m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-205	39	46	1A,m8	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-25/32/92/363/367	904	910	m8	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-330	1096	1103	1A,m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-496	2789	2795	1A	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TRAK2