SZGR2

Summary ?

GeneID	6605
Symbol	SMARCE1
Synonyms	BAF57
Description	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1
Reference	MIM:603111\|HGNC:HGNC:11109\|HPRD:04382\|
Gene type	protein-coding
Map location	17q21.2
Pascal p-value	0.749
Sherlock p-value	0.315
Fetal beta	1.915
eGene	Myers' cis & trans
Support	Chromatin Remodeling Genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0447

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs8074179	chr17	38770964	SMARCE1	6605	0.17	cis
rs2429548	chr17	38851968	SMARCE1	6605	0.05	cis
rs2429552	chr17	38868479	SMARCE1	6605	0.07	cis

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PPP1R12B	0.85	0.84
AP000751.3	0.83	0.81
HECW2	0.82	0.82
CDYL2	0.82	0.80
SIK2	0.82	0.80
PLEKHM3	0.81	0.82
ZFP106	0.81	0.83
CPEB3	0.81	0.83
DLGAP1	0.81	0.76
C17orf51	0.80	0.79

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C1orf61	-0.48	-0.57
RHOC	-0.48	-0.56
AF347015.21	-0.47	-0.49
DBI	-0.47	-0.54
C1orf54	-0.46	-0.53
SYCP3	-0.46	-0.51
C16orf74	-0.45	-0.47
IL32	-0.44	-0.53
RAB34	-0.44	-0.50
AL050337.1	-0.44	-0.51

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
GO:0003682	chromatin binding	TAS		9435219
GO:0003713	transcription coactivator activity	TAS		9435219
GO:0008080	N-acetyltransferase activity	IDA		12192000
GO:0047485	protein N-terminus binding	IPI		12917342
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006337	nucleosome disassembly	TAS		9435219
GO:0006357	regulation of transcription from RNA polymerase II promoter	TAS		9435219
GO:0016568	chromatin modification	IEA		-
GO:0045892	negative regulation of transcription, DNA-dependent	IDA		12192000
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000228	nuclear chromosome	TAS		9435219
GO:0005634	nucleus	IEA		-
GO:0005730	nucleolus	IDA		18029348
GO:0017053	transcriptional repressor complex	IPI		12192000

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTB	PS1TP5BP1	actin, beta	Affinity Capture-Western	BioGRID	9845365
ACTL6A	ACTL6 \| Arp4 \| BAF53A \| INO80K \| MGC5382	actin-like 6A	Affinity Capture-Western	BioGRID	9845365
BAZ1B	WBSCR10 \| WBSCR9 \| WSTF	bromodomain adjacent to zinc finger domain, 1B	-	HPRD,BioGRID	12837248
DISC1	C1orf136 \| FLJ13381 \| FLJ21640 \| FLJ25311 \| FLJ41105 \| KIAA0457 \| SCZD9	disrupted in schizophrenia 1	An unspecified isoform of DISC1 interacts with SMARCE1.	BIND	14623284
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	-	HPRD,BioGRID	12145209
ESR2	ER-BETA \| ESR-BETA \| ESRB \| ESTRB \| Erb \| NR3A2	estrogen receptor 2 (ER beta)	-	HPRD,BioGRID	12145209
GATA1	ERYF1 \| GF-1 \| GF1 \| NFE1	GATA binding protein 1 (globin transcription factor 1)	Reconstituted Complex	BioGRID	11018012
KLF1	EKLF	Kruppel-like factor 1 (erythroid)	Reconstituted Complex	BioGRID	11018012
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	-	HPRD,BioGRID	12145209
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	-	HPRD	12145209
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	-	HPRD,BioGRID	12917342
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	-	HPRD	9710619
RELB	I-REL \| IREL	v-rel reticuloendotheliosis viral oncogene homolog B	Affinity Capture-MS	BioGRID	14743216
SMARCA2	BAF190 \| BRM \| FLJ36757 \| MGC74511 \| SNF2 \| SNF2L2 \| SNF2LA \| SWI2 \| Sth1p \| hBRM \| hSNF2a	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	Co-purification	BioGRID	8895581
SMARCA4	BAF190 \| BRG1 \| FLJ39786 \| SNF2 \| SNF2-BETA \| SNF2L4 \| SNF2LB \| SWI2 \| hSNF2b	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	Affinity Capture-Western Co-purification	BioGRID	8895581 \|9845365
SMARCB1	BAF47 \| INI1 \| RDT \| SNF5 \| SNF5L1 \| Sfh1p \| Snr1 \| hSNFS	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	Affinity Capture-Western Co-purification	BioGRID	8895581 \|9845365
SMARCC1	BAF155 \| CRACC1 \| Rsc8 \| SRG3 \| SWI3	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	Affinity Capture-Western	BioGRID	9845365
SMARCC2	BAF170 \| CRACC2 \| Rsc8	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	Affinity Capture-Western	BioGRID	9845365
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	-	HPRD	12145209
STAT2	ISGF-3 \| MGC59816 \| P113 \| STAT113	signal transducer and activator of transcription 2, 113kDa	Affinity Capture-Western	BioGRID	12244326
TFE3	RCCP2 \| TFEA \| bHLHe33	transcription factor binding to IGHM enhancer 3	Reconstituted Complex	BioGRID	11018012

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID ERB GENOMIC PATHWAY	15	8	All SZGR 2.0 genes in this pathway
PID AR TF PATHWAY	53	38	All SZGR 2.0 genes in this pathway
HOLLMANN APOPTOSIS VIA CD40 DN	267	178	All SZGR 2.0 genes in this pathway
HORIUCHI WTAP TARGETS UP	306	188	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN	770	415	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION	77	51	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS LUMINAL	326	213	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
LIAO METASTASIS	539	324	All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN	165	104	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 17Q11 Q21 AMPLICON	133	78	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP	151	100	All SZGR 2.0 genes in this pathway
PARK HSC AND MULTIPOTENT PROGENITORS	50	33	All SZGR 2.0 genes in this pathway
ZHOU TNF SIGNALING 4HR	54	36	All SZGR 2.0 genes in this pathway
PAL PRMT5 TARGETS UP	203	135	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN	298	200	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 2D UP	69	46	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP	973	570	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER UP	298	174	All SZGR 2.0 genes in this pathway
ASGHARZADEH NEUROBLASTOMA POOR SURVIVAL DN	46	30	All SZGR 2.0 genes in this pathway
GYORFFY MITOXANTRONE RESISTANCE	57	35	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
KIM TIAL1 TARGETS	32	22	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	292	299	1A,m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	292	299	1A,m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-494	1030	1036	m8	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-9	730	736	1A	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SMARCE1