SZGR2

Summary ?

GeneID	6622
Symbol	SNCA
Synonyms	NACP\|PARK1\|PARK4\|PD1
Description	synuclein alpha
Reference	MIM:163890\|HGNC:HGNC:11138\|Ensembl:ENSG00000145335\|HPRD:01227\|Vega:OTTHUMG00000130948
Gene type	protein-coding
Map location	4q21
Pascal p-value	0.012
Sherlock p-value	0.516
Fetal beta	-1.991
DMG	1 (# studies)
Support	G2Cdb.human_clathrin G2Cdb.human_Synaptosome

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 7
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0635

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg15452573	4	90758843	SNCA		-0.019	0.77	DMG:Nishioka_2013

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PALLD	0.91	0.84
NR2E1	0.87	0.78
NOTCH1	0.86	0.81
SOX2	0.86	0.84
YAP1	0.85	0.75
AL161668.2	0.85	0.83
LTBP1	0.85	0.74
SIX5	0.84	0.67
FBXL7	0.84	0.80
TGIF2	0.84	0.69

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SERPINI1	-0.31	-0.28
C5orf53	-0.31	-0.30
RERGL	-0.30	-0.35
CHN1	-0.30	-0.20
SERGEF	-0.30	-0.32
TMEM155	-0.29	-0.26
CA4	-0.29	-0.26
NRSN1	-0.29	-0.25
NDUFB9	-0.29	-0.39
ZFAND2A	-0.29	-0.33

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0042802	identical protein binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007417	central nervous system development	TAS	Brain (GO term level: 6)	9197268
GO:0048169	regulation of long-term neuronal synaptic plasticity	IEA	neuron, Synap (GO term level: 10)	-
GO:0001963	synaptic transmission, dopaminergic	IEA	neuron, Synap, Neurotransmitter, dopamine (GO term level: 8)	-
GO:0048489	synaptic vesicle transport	IEA	neuron, Synap (GO term level: 6)	-
GO:0001956	positive regulation of neurotransmitter secretion	IEA	Neurotransmitter (GO term level: 10)	-
GO:0042416	dopamine biosynthetic process	IEA	Neurotransmitter, dopamine (GO term level: 9)	-
GO:0006644	phospholipid metabolic process	IEA		-
GO:0006916	anti-apoptosis	TAS		10818098
GO:0042493	response to drug	IEA		-
GO:0040012	regulation of locomotion	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0019717	synaptosome	IEA	Synap, Brain (GO term level: 7)	-
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	TAS		8248242
GO:0016020	membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
APP	AAA \| ABETA \| ABPP \| AD1 \| APPI \| CTFgamma \| CVAP \| PN2	amyloid beta (A4) precursor protein	-	HPRD,BioGRID	9163350
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	Reconstituted Complex	BioGRID	11742726
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	-	HPRD	10407019
BAX	BCL2L4	BCL2-associated X protein	Reconstituted Complex	BioGRID	11742726
BCL2L1	BCL-XL/S \| BCL2L \| BCLX \| Bcl-X \| DKFZp781P2092 \| bcl-xL \| bcl-xS	BCL2-like 1	-	HPRD	11742726
CALM1	CALML2 \| CAMI \| DD132 \| PHKD	calmodulin 1 (phosphorylase kinase, delta)	-	HPRD,BioGRID	12358748
COL25A1	CLAC \| CLACP	collagen, type XXV, alpha 1	-	HPRD	15522881
CPOX	CPO \| CPX \| HCP	coproporphyrinogen oxidase	-	HPRD,BioGRID	12059041
CYCS	CYC \| HCS	cytochrome c, somatic	-	HPRD	10506125
ELK1	-	ELK1, member of ETS oncogene family	-	HPRD	11279280
FYN	MGC45350 \| SLK \| SYN	FYN oncogene related to SRC, FGR, YES	-	HPRD,BioGRID	11162638
GRK1	GPRK1 \| RHOK \| RK	G protein-coupled receptor kinase 1	Biochemical Activity	BioGRID	10852916
GRK5	GPRK5	G protein-coupled receptor kinase 5	Biochemical Activity	BioGRID	10852916
GRK6	FLJ32135 \| GPRK6	G protein-coupled receptor kinase 6	Biochemical Activity	BioGRID	10852916
LAMP2	CD107b \| LAMPB \| LGP110	lysosomal-associated membrane protein 2	alpha-synuclein interacts with lamp2a. This interaction was modeled on a demonstrated interaction between human alpha-synuclein and rat lamp2a.	BIND	15333840
MAP1B	DKFZp686E1099 \| DKFZp686F1345 \| FLJ38954 \| FUTSCH \| MAP5	microtubule-associated protein 1B	-	HPRD,BioGRID	10764738
MAPK1	ERK \| ERK2 \| ERT1 \| MAPK2 \| P42MAPK \| PRKM1 \| PRKM2 \| p38 \| p40 \| p41 \| p41mapk	mitogen-activated protein kinase 1	Affinity Capture-Western	BioGRID	12121974
MAPK1	ERK \| ERK2 \| ERT1 \| MAPK2 \| P42MAPK \| PRKM1 \| PRKM2 \| p38 \| p40 \| p41 \| p41mapk	mitogen-activated protein kinase 1	-	HPRD	11279280
MAPK3	ERK1 \| HS44KDAP \| HUMKER1A \| MGC20180 \| P44ERK1 \| P44MAPK \| PRKM3	mitogen-activated protein kinase 3	Affinity Capture-Western	BioGRID	12121974
MAPK8	JNK \| JNK1 \| JNK1A2 \| JNK21B1/2 \| PRKM8 \| SAPK1	mitogen-activated protein kinase 8	Affinity Capture-Western	BioGRID	12121974
MAPK8IP1	IB1 \| JIP-1 \| JIP1 \| PRKM8IP	mitogen-activated protein kinase 8 interacting protein 1	-	HPRD	11790792
MAPT	DDPAC \| FLJ31424 \| FTDP-17 \| MAPTL \| MGC138549 \| MSTD \| MTBT1 \| MTBT2 \| PPND \| TAU	microtubule-associated protein tau	-	HPRD,BioGRID	10464279
PARK2	AR-JP \| LPRS2 \| PDJ \| PRKN	Parkinson disease (autosomal recessive, juvenile) 2, parkin	-	HPRD,BioGRID	11588587
PLD1	-	phospholipase D1, phosphatidylcholine-specific	-	HPRD,BioGRID	11821392
PRKCE	MGC125656 \| MGC125657 \| PKCE \| nPKC-epsilon	protein kinase C, epsilon	-	HPRD	10407019
SEPT2	DIFF6 \| KIAA0158 \| NEDD5 \| Pnutl3 \| hNedd5	septin 2	Affinity Capture-Western	BioGRID	12695511
SEPT4	ARTS \| BRADEION \| CE5B3 \| H5 \| MART \| PNUTL2 \| SEP4 \| hCDCREL-2 \| hucep-7	septin 4	Affinity Capture-Western	BioGRID	12695511
SLC6A3	DAT \| DAT1	solute carrier family 6 (neurotransmitter transporter, dopamine), member 3	Alpha-synuclein interacts with hDAT.	BIND	14550771
SLC6A3	DAT \| DAT1	solute carrier family 6 (neurotransmitter transporter, dopamine), member 3	-	HPRD,BioGRID	12672538
SNCAIP	MGC39814 \| SYPH1	synuclein, alpha interacting protein	Affinity Capture-Western FRET Reconstituted Complex Two-hybrid	BioGRID	10319874 \|11331421 \|11742726 \|12044636
SNCAIP	MGC39814 \| SYPH1	synuclein, alpha interacting protein	SNCAIP interacts with SNCA.	BIND	10319874
SNCAIP	MGC39814 \| SYPH1	synuclein, alpha interacting protein	-	HPRD	10319874 \|11331421 \|12044636
SNCB	-	synuclein, beta	-	HPRD,BioGRID	11683992
SQSTM1	A170 \| OSIL \| PDB3 \| ZIP3 \| p60 \| p62 \| p62B	sequestosome 1	-	HPRD	11447312
TH	TYH	tyrosine hydroxylase	-	HPRD	11943812
TOR1A	DQ2 \| DYT1	torsin family 1, member A (torsin A)	-	HPRD,BioGRID	11438481
TUBA1A	B-ALPHA-1 \| FLJ25113 \| LIS3 \| TUBA3	tubulin, alpha 1a	-	HPRD	11687285
UCHL1	PARK5 \| PGP9.5 \| Uch-L1	ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)	-	HPRD	11603807
YWHAB	GW128 \| HS1 \| KCIP-1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide	-	HPRD	10407019
YWHAE	14-3-3E \| FLJ45465 \| KCIP-1 \| MDCR \| MDS	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide	-	HPRD	10407019

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ALZHEIMERS DISEASE	169	110	All SZGR 2.0 genes in this pathway
KEGG PARKINSONS DISEASE	133	78	All SZGR 2.0 genes in this pathway
BIOCARTA PARKIN PATHWAY	13	8	All SZGR 2.0 genes in this pathway
PID ALPHA SYNUCLEIN PATHWAY	33	25	All SZGR 2.0 genes in this pathway
REACTOME AMYLOIDS	83	63	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN	226	132	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 DN	67	43	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP	633	376	All SZGR 2.0 genes in this pathway
HAHTOLA SEZARY SYNDROM UP	98	58	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN UP	177	113	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES UP	19	15	All SZGR 2.0 genes in this pathway
TANG SENESCENCE TP53 TARGETS UP	33	20	All SZGR 2.0 genes in this pathway
XU HGF TARGETS INDUCED BY AKT1 48HR DN	27	17	All SZGR 2.0 genes in this pathway
DAIRKEE TERT TARGETS UP	380	213	All SZGR 2.0 genes in this pathway
CEBALLOS TARGETS OF TP53 AND MYC DN	38	31	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM1	229	137	All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 20 MCF10A	21	10	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS DN	108	84	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED DN	246	180	All SZGR 2.0 genes in this pathway
HOEGERKORP CD44 TARGETS TEMPORAL DN	25	16	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS MATURE CELL	293	160	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM DN	86	66	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR UP	180	125	All SZGR 2.0 genes in this pathway
XU GH1 EXOGENOUS TARGETS UP	85	50	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP	487	303	All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP	268	157	All SZGR 2.0 genes in this pathway
HOWLIN CITED1 TARGETS 1 UP	35	25	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
GRADE COLON AND RECTAL CANCER DN	101	65	All SZGR 2.0 genes in this pathway
MALONEY RESPONSE TO 17AAG DN	79	45	All SZGR 2.0 genes in this pathway
MOOTHA MITOCHONDRIA	447	277	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN	435	289	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 8	26	17	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS ICP WITH H3K4ME3 AND H327ME3	126	83	All SZGR 2.0 genes in this pathway
HAHTOLA CTCL CUTANEOUS	26	19	All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN	253	192	All SZGR 2.0 genes in this pathway
RAGHAVACHARI PLATELET SPECIFIC GENES	70	46	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP	504	321	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
ISSAEVA MLL2 TARGETS	62	35	All SZGR 2.0 genes in this pathway
VANDESLUIS COMMD1 TARGETS GROUP 3 UP	89	50	All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS UP	163	111	All SZGR 2.0 genes in this pathway
PLASARI NFIC TARGETS BASAL UP	27	17	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 PARTIAL	160	106	All SZGR 2.0 genes in this pathway
FOSTER KDM1A TARGETS UP	266	142	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-153	459	465	m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-324-3p	131	137	1A	hsa-miR-324-3p	CCACUGCCCCAGGUGCUGCUGG
miR-495	417	423	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-539	89	96	1A,m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU
miR-7	120	127	1A,m8	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SNCA