Gene Page: SNTA1
Summary ?
GeneID | 6640 |
Symbol | SNTA1 |
Synonyms | LQT12|SNT1|TACIP1|dJ1187J4.5 |
Description | syntrophin alpha 1 |
Reference | MIM:601017|HGNC:HGNC:11167|Ensembl:ENSG00000101400|HPRD:03009|Vega:OTTHUMG00000032259 |
Gene type | protein-coding |
Map location | 20q11.2 |
Pascal p-value | 0.421 |
Sherlock p-value | 0.057 |
Fetal beta | -1.849 |
DMG | 1 (# studies) |
eGene | Meta |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 1 |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0279 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
SNTA1 | chr20 | 31997942 | T | C | NM_003098 NM_003098 | . . | silent splice-donor-ex2ag | Schizophrenia | DNM:Fromer_2014 |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg15056412 | 20 | 32262523 | SNTA1 | 0.001 | 6.267 | DMG:vanEijk_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003779 | actin binding | IEA | - | |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0005516 | calmodulin binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007528 | neuromuscular junction development | IEA | Synap (GO term level: 10) | - |
GO:0006936 | muscle contraction | TAS | 8576247 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0045211 | postsynaptic membrane | IEA | Synap, Neurotransmitter (GO term level: 5) | - |
GO:0005856 | cytoskeleton | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0042383 | sarcolemma | IEA | - | |
GO:0030054 | cell junction | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
CALM1 | CALML2 | CAMI | DD132 | PHKD | calmodulin 1 (phosphorylase kinase, delta) | - | HPRD | 9512352 |
DGKZ | DAGK5 | DAGK6 | DGK-ZETA | hDGKzeta | diacylglycerol kinase, zeta 104kDa | - | HPRD,BioGRID | 11352924 |
DMD | BMD | CMD3B | DXS142 | DXS164 | DXS206 | DXS230 | DXS239 | DXS268 | DXS269 | DXS270 | DXS272 | dystrophin | - | HPRD,BioGRID | 7890602 |
DTNA | D18S892E | DRP3 | DTN | FLJ96209 | LVNC1 | dystrobrevin, alpha | - | HPRD | 12206805 |
DTNA | D18S892E | DRP3 | DTN | FLJ96209 | LVNC1 | dystrobrevin, alpha | - | HPRD | 11069112 |12206805|12206805 |
DTNB | MGC17163 | MGC57126 | dystrobrevin, beta | Affinity Capture-Western | BioGRID | 10545507 |
GLS | AAD20 | DKFZp686O15119 | FLJ10358 | GLS1 | KIAA0838 | glutaminase | - | HPRD,BioGRID | 11163757 |
GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD,BioGRID | 11278583 |11551227 |
KCNJ12 | FLJ14167 | IRK2 | KCNJN1 | Kir2.2 | Kir2.2v | hIRK | hIRK1 | hkir2.2x | kcnj12x | potassium inwardly-rectifying channel, subfamily J, member 12 | - | HPRD,BioGRID | 15024025 |
KCNJ4 | HIR | HIRK2 | HRK1 | IRK3 | Kir2.3 | MGC142066 | MGC142068 | potassium inwardly-rectifying channel, subfamily J, member 4 | Affinity Capture-Western | BioGRID | 15024025 |
MAPK12 | ERK3 | ERK6 | P38GAMMA | PRKM12 | SAPK-3 | SAPK3 | mitogen-activated protein kinase 12 | Affinity Capture-Western Biochemical Activity Two-hybrid | BioGRID | 10212242 |
NOS1 | IHPS1 | NOS | nNOS | nitric oxide synthase 1 (neuronal) | - | HPRD | 11747091 |
NOS1 | IHPS1 | NOS | nNOS | nitric oxide synthase 1 (neuronal) | Reconstituted Complex | BioGRID | 9412493 |
SCN1A | FEB3 | GEFSP2 | HBSCI | NAC1 | Nav1.1 | SCN1 | SMEI | sodium channel, voltage-gated, type I, alpha subunit | Affinity Capture-Western Protein-peptide | BioGRID | 9412493 |
SCN5A | CDCD2 | CMD1E | CMPD2 | HB1 | HB2 | HBBD | HH1 | ICCD | IVF | LQT3 | Nav1.5 | PFHB1 | SSS1 | sodium channel, voltage-gated, type V, alpha subunit | Affinity Capture-Western Protein-peptide | BioGRID | 9412493 |
UTRN | DMDL | DRP | DRP1 | FLJ23678 | utrophin | - | HPRD,BioGRID | 8576247 |
XRCC6 | CTC75 | CTCBF | G22P1 | KU70 | ML8 | TLAA | X-ray repair complementing defective repair in Chinese hamster cells 6 | Two-hybrid | BioGRID | 16169070 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID P38 GAMMA DELTA PATHWAY | 11 | 9 | All SZGR 2.0 genes in this pathway |
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP | 368 | 234 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN UP | 184 | 125 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER DN | 232 | 154 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 3 UP | 329 | 196 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS F UP | 185 | 119 | All SZGR 2.0 genes in this pathway |
LUI THYROID CANCER PAX8 PPARG DN | 45 | 29 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
YAGI AML FAB MARKERS | 191 | 131 | All SZGR 2.0 genes in this pathway |
MOREAUX B LYMPHOCYTE MATURATION BY TACI UP | 92 | 58 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
LEE AGING CEREBELLUM UP | 84 | 58 | All SZGR 2.0 genes in this pathway |
KAYO CALORIE RESTRICTION MUSCLE UP | 95 | 64 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
GREGORY SYNTHETIC LETHAL WITH IMATINIB | 145 | 83 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS UP | 217 | 131 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS GROUP1 | 136 | 76 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 234 | 240 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-135 | 268 | 274 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-185 | 488 | 494 | m8 | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
miR-34b | 67 | 73 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.