SZGR2

Summary ?

GeneID	6640
Symbol	SNTA1
Synonyms	LQT12\|SNT1\|TACIP1\|dJ1187J4.5
Description	syntrophin alpha 1
Reference	MIM:601017\|HGNC:HGNC:11167\|Ensembl:ENSG00000101400\|HPRD:03009\|Vega:OTTHUMG00000032259
Gene type	protein-coding
Map location	20q11.2
Pascal p-value	0.421
Sherlock p-value	0.057
Fetal beta	-1.849
DMG	1 (# studies)
eGene	Meta
Support	G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:vanEijk_2014	Genome-wide DNA methylation analysis	This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250).	1
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0279

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
SNTA1	chr20	31997942	T	C	NM_003098 NM_003098	. .	silent splice-donor-ex2ag			Schizophrenia	DNM:Fromer_2014

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg15056412	20	32262523	SNTA1	0.001	6.267		DMG:vanEijk_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003779	actin binding	IEA		-
GO:0005509	calcium ion binding	IEA		-
GO:0005516	calmodulin binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007528	neuromuscular junction development	IEA	Synap (GO term level: 10)	-
GO:0006936	muscle contraction	TAS		8576247
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0045211	postsynaptic membrane	IEA	Synap, Neurotransmitter (GO term level: 5)	-
GO:0005856	cytoskeleton	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0042383	sarcolemma	IEA		-
GO:0030054	cell junction	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CALM1	CALML2 \| CAMI \| DD132 \| PHKD	calmodulin 1 (phosphorylase kinase, delta)	-	HPRD	9512352
DGKZ	DAGK5 \| DAGK6 \| DGK-ZETA \| hDGKzeta	diacylglycerol kinase, zeta 104kDa	-	HPRD,BioGRID	11352924
DMD	BMD \| CMD3B \| DXS142 \| DXS164 \| DXS206 \| DXS230 \| DXS239 \| DXS268 \| DXS269 \| DXS270 \| DXS272	dystrophin	-	HPRD,BioGRID	7890602
DTNA	D18S892E \| DRP3 \| DTN \| FLJ96209 \| LVNC1	dystrobrevin, alpha	-	HPRD	12206805
DTNA	D18S892E \| DRP3 \| DTN \| FLJ96209 \| LVNC1	dystrobrevin, alpha	-	HPRD	11069112 \|12206805\|12206805
DTNB	MGC17163 \| MGC57126	dystrobrevin, beta	Affinity Capture-Western	BioGRID	10545507
GLS	AAD20 \| DKFZp686O15119 \| FLJ10358 \| GLS1 \| KIAA0838	glutaminase	-	HPRD,BioGRID	11163757
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD,BioGRID	11278583 \|11551227
KCNJ12	FLJ14167 \| IRK2 \| KCNJN1 \| Kir2.2 \| Kir2.2v \| hIRK \| hIRK1 \| hkir2.2x \| kcnj12x	potassium inwardly-rectifying channel, subfamily J, member 12	-	HPRD,BioGRID	15024025
KCNJ4	HIR \| HIRK2 \| HRK1 \| IRK3 \| Kir2.3 \| MGC142066 \| MGC142068	potassium inwardly-rectifying channel, subfamily J, member 4	Affinity Capture-Western	BioGRID	15024025
MAPK12	ERK3 \| ERK6 \| P38GAMMA \| PRKM12 \| SAPK-3 \| SAPK3	mitogen-activated protein kinase 12	Affinity Capture-Western Biochemical Activity Two-hybrid	BioGRID	10212242
NOS1	IHPS1 \| NOS \| nNOS	nitric oxide synthase 1 (neuronal)	-	HPRD	11747091
NOS1	IHPS1 \| NOS \| nNOS	nitric oxide synthase 1 (neuronal)	Reconstituted Complex	BioGRID	9412493
SCN1A	FEB3 \| GEFSP2 \| HBSCI \| NAC1 \| Nav1.1 \| SCN1 \| SMEI	sodium channel, voltage-gated, type I, alpha subunit	Affinity Capture-Western Protein-peptide	BioGRID	9412493
SCN5A	CDCD2 \| CMD1E \| CMPD2 \| HB1 \| HB2 \| HBBD \| HH1 \| ICCD \| IVF \| LQT3 \| Nav1.5 \| PFHB1 \| SSS1	sodium channel, voltage-gated, type V, alpha subunit	Affinity Capture-Western Protein-peptide	BioGRID	9412493
UTRN	DMDL \| DRP \| DRP1 \| FLJ23678	utrophin	-	HPRD,BioGRID	8576247
XRCC6	CTC75 \| CTCBF \| G22P1 \| KU70 \| ML8 \| TLAA	X-ray repair complementing defective repair in Chinese hamster cells 6	Two-hybrid	BioGRID	16169070

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID P38 GAMMA DELTA PATHWAY	11	9	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP	368	234	All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN UP	184	125	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP	530	342	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN	232	154	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 UP	329	196	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS F UP	185	119	All SZGR 2.0 genes in this pathway
LUI THYROID CANCER PAX8 PPARG DN	45	29	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP	487	286	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
YAGI AML FAB MARKERS	191	131	All SZGR 2.0 genes in this pathway
MOREAUX B LYMPHOCYTE MATURATION BY TACI UP	92	58	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM UP	84	58	All SZGR 2.0 genes in this pathway
KAYO CALORIE RESTRICTION MUSCLE UP	95	64	All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL	311	205	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS UP	317	208	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2	491	319	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP	756	494	All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP	682	440	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL	162	122	All SZGR 2.0 genes in this pathway
GREGORY SYNTHETIC LETHAL WITH IMATINIB	145	83	All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS UP	217	131	All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS GROUP1	136	76	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124/506	234	240	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	234	240	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-135	268	274	m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	268	274	m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-185	488	494	m8	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-34b	67	73	m8	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SNTA1