Gene Page: SREBF1
Summary ?
GeneID | 6720 |
Symbol | SREBF1 |
Synonyms | SREBP-1c|SREBP1|SREBP1a|bHLHd1 |
Description | sterol regulatory element binding transcription factor 1 |
Reference | MIM:184756|HGNC:HGNC:11289|Ensembl:ENSG00000072310|HPRD:01701|Vega:OTTHUMG00000059313 |
Gene type | protein-coding |
Map location | 17p11.2 |
Pascal p-value | 2.674E-7 |
Fetal beta | -0.234 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0033 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg03641529 | 17 | 17716218 | SREBF1 | 1.292E-4 | 0.599 | 0.03 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SP1 | 0.89 | 0.91 |
TCF12 | 0.88 | 0.87 |
ZFAND3 | 0.88 | 0.84 |
TOB2 | 0.88 | 0.86 |
PARP1 | 0.87 | 0.84 |
REST | 0.87 | 0.86 |
FUBP3 | 0.87 | 0.84 |
PHF8 | 0.86 | 0.86 |
CTDSP2 | 0.86 | 0.85 |
DHTKD1 | 0.86 | 0.83 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.60 | -0.68 |
IFI27 | -0.57 | -0.61 |
IL32 | -0.54 | -0.63 |
AF347015.31 | -0.54 | -0.60 |
MT-CO2 | -0.54 | -0.59 |
C1orf54 | -0.53 | -0.59 |
CXCL14 | -0.53 | -0.60 |
MYL3 | -0.53 | -0.56 |
SYCP3 | -0.52 | -0.55 |
AC044839.2 | -0.51 | -0.60 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IDA | 16407292 | |
GO:0003702 | RNA polymerase II transcription factor activity | TAS | 8156598 | |
GO:0005515 | protein binding | IPI | 16799563 | |
GO:0032810 | sterol response element binding | IDA | 16407292 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006357 | regulation of transcription from RNA polymerase II promoter | TAS | 8156598 | |
GO:0008202 | steroid metabolic process | IEA | - | |
GO:0008203 | cholesterol metabolic process | IEA | - | |
GO:0009267 | cellular response to starvation | ISS | 16407292 | |
GO:0006629 | lipid metabolic process | TAS | 8156598 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000139 | Golgi membrane | IEA | - | |
GO:0005794 | Golgi apparatus | IEA | - | |
GO:0005789 | endoplasmic reticulum membrane | TAS | 8156598 | |
GO:0005634 | nucleus | TAS | 8156598 | |
GO:0005635 | nuclear envelope | TAS | 8156598 | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0031410 | cytoplasmic vesicle | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
SA CASPASE CASCADE | 19 | 13 | All SZGR 2.0 genes in this pathway |
PID MTOR 4PATHWAY | 69 | 55 | All SZGR 2.0 genes in this pathway |
PID RXR VDR PATHWAY | 26 | 24 | All SZGR 2.0 genes in this pathway |
PID CASPASE PATHWAY | 52 | 39 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME PPARA ACTIVATES GENE EXPRESSION | 104 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME RORA ACTIVATES CIRCADIAN EXPRESSION | 24 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
REACTOME FATTY ACID TRIACYLGLYCEROL AND KETONE BODY METABOLISM | 168 | 115 | All SZGR 2.0 genes in this pathway |
REACTOME CIRCADIAN CLOCK | 53 | 40 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSCRIPTIONAL REGULATION OF WHITE ADIPOCYTE DIFFERENTIATION | 72 | 53 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS BASAL | 330 | 217 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER CLUSTER 7 | 20 | 11 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE DN | 245 | 154 | All SZGR 2.0 genes in this pathway |
NADLER OBESITY DN | 48 | 34 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
DASU IL6 SIGNALING SCAR UP | 30 | 21 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 4 | 48 | 32 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C5 | 46 | 36 | All SZGR 2.0 genes in this pathway |
BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B UP | 172 | 109 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S3 | 266 | 180 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC UP | 72 | 53 | All SZGR 2.0 genes in this pathway |
SENGUPTA EBNA1 ANTICORRELATED | 173 | 85 | All SZGR 2.0 genes in this pathway |
DASU IL6 SIGNALING UP | 59 | 44 | All SZGR 2.0 genes in this pathway |
MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
ZWANG EGF INTERVAL DN | 214 | 124 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-142-5p | 486 | 492 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.