Gene Page: STAT5A
Summary ?
| GeneID | 6776 |
| Symbol | STAT5A |
| Synonyms | MGF|STAT5 |
| Description | signal transducer and activator of transcription 5A |
| Reference | MIM:601511|HGNC:HGNC:11366|Ensembl:ENSG00000126561|HPRD:03301|Vega:OTTHUMG00000150725 |
| Gene type | protein-coding |
| Map location | 17q11.2 |
| Pascal p-value | 0.527 |
| Sherlock p-value | 0.077 |
| Fetal beta | -0.912 |
| DMG | 1 (# studies) |
| eGene | Nucleus accumbens basal ganglia Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.2058 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg12259792 | 17 | 40442580 | STAT5A | 4.685E-4 | -0.275 | 0.046 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs9431457 | chr1 | 221425020 | STAT5A | 6776 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004871 | signal transducer activity | IEA | - | |
| GO:0003700 | transcription factor activity | TAS | 7719937 |8631883 | |
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 16819511 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0001553 | luteinization | IEA | - | |
| GO:0001779 | natural killer cell differentiation | IEA | - | |
| GO:0007259 | JAK-STAT cascade | TAS | 7719937 | |
| GO:0007165 | signal transduction | IEA | - | |
| GO:0008284 | positive regulation of cell proliferation | IEA | - | |
| GO:0019915 | sequestering of lipid | IEA | - | |
| GO:0007595 | lactation | IEA | - | |
| GO:0007565 | female pregnancy | IEA | - | |
| GO:0043066 | negative regulation of apoptosis | IEA | - | |
| GO:0030155 | regulation of cell adhesion | IEA | - | |
| GO:0042104 | positive regulation of activated T cell proliferation | IEA | - | |
| GO:0040018 | positive regulation of multicellular organism growth | IEA | - | |
| GO:0030879 | mammary gland development | IEA | - | |
| GO:0030856 | regulation of epithelial cell differentiation | IEA | - | |
| GO:0019218 | regulation of steroid metabolic process | IEA | - | |
| GO:0019221 | cytokine-mediated signaling pathway | IEA | - | |
| GO:0043029 | T cell homeostasis | IEA | - | |
| GO:0045579 | positive regulation of B cell differentiation | IEA | - | |
| GO:0045647 | negative regulation of erythrocyte differentiation | IEA | - | |
| GO:0045885 | positive regulation of survival gene product expression | IEA | - | |
| GO:0045931 | positive regulation of mitotic cell cycle | IEA | - | |
| GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
| GO:0050729 | positive regulation of inflammatory response | IEA | - | |
| GO:0045086 | positive regulation of interleukin-2 biosynthetic process | IEA | - | |
| GO:0046543 | development of secondary female sexual characteristics | IEA | - | |
| GO:0046544 | development of secondary male sexual characteristics | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| BMX | ETK | PSCTK2 | PSCTK3 | BMX non-receptor tyrosine kinase | - | HPRD | 9373245 |
| BRCA1 | BRCAI | BRCC1 | IRIS | PSCP | RNF53 | breast cancer 1, early onset | - | HPRD,BioGRID | 12459499 |
| BRCA2 | BRCC2 | FACD | FAD | FAD1 | FANCB | FANCD | FANCD1 | breast cancer 2, early onset | - | HPRD,BioGRID | 12459499 |
| CCND2 | KIAK0002 | MGC102758 | cyclin D2 | STAT5A interacts with Cyclin D2 promoter. | BIND | 15735688 |
| CD247 | CD3-ZETA | CD3H | CD3Q | CD3Z | T3Z | TCRZ | CD247 molecule | - | HPRD,BioGRID | 9880255 |
| CEBPB | C/EBP-beta | CRP2 | IL6DBP | LAP | MGC32080 | NF-IL6 | TCF5 | CCAAT/enhancer binding protein (C/EBP), beta | - | HPRD | 11158330 |
| CENPJ | BM032 | CPAP | LAP | LIP1 | MCPH6 | MGC131581 | MGC131582 | MGC142222 | MGC142224 | centromere protein J | - | HPRD | 12198240 |
| CRKL | - | v-crk sarcoma virus CT10 oncogene homolog (avian)-like | - | HPRD,BioGRID | 9837784 |11167825 |
| EGFR | ERBB | ERBB1 | HER1 | PIG61 | mENA | epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) | - | HPRD,BioGRID | 10358079 |
| EPOR | MGC138358 | erythropoietin receptor | - | HPRD,BioGRID | 8977232 |
| ERBB4 | HER4 | MGC138404 | p180erbB4 | v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) | Affinity Capture-MS Affinity Capture-Western | BioGRID | 15534001 |16729043 |
| ESR1 | DKFZp686N23123 | ER | ESR | ESRA | Era | NR3A1 | estrogen receptor 1 | ER-alpha interacts with STAT5a. | BIND | 15304355 |
| ESR1 | DKFZp686N23123 | ER | ESR | ESRA | Era | NR3A1 | estrogen receptor 1 | Reconstituted Complex | BioGRID | 11682624 |
| ESR2 | ER-BETA | ESR-BETA | ESRB | ESTRB | Erb | NR3A2 | estrogen receptor 2 (ER beta) | - | HPRD,BioGRID | 11682624 |
| GHR | GHBP | growth hormone receptor | - | HPRD | 8702683 |
| IL2RB | CD122 | P70-75 | interleukin 2 receptor, beta | - | HPRD,BioGRID | 10602027 |
| IL2RG | CD132 | IMD4 | SCIDX | SCIDX1 | interleukin 2 receptor, gamma (severe combined immunodeficiency) | - | HPRD | 11418623 |
| IL5 | EDF | IL-5 | TRF | interleukin 5 (colony-stimulating factor, eosinophil) | STAT5A interacts with IL-5 promoter. | BIND | 15735688 |
| IL9 | HP40 | IL-9 | P40 | interleukin 9 | STAT5A interacts with IL-9 promoter. | BIND | 15735688 |
| JAK1 | JAK1A | JAK1B | JTK3 | Janus kinase 1 (a protein tyrosine kinase) | - | HPRD | 11722592 |
| JAK1 | JAK1A | JAK1B | JTK3 | Janus kinase 1 (a protein tyrosine kinase) | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 9047382 |
| JAK2 | JTK10 | Janus kinase 2 (a protein tyrosine kinase) | - | HPRD,BioGRID | 9575217 |
| JAK3 | JAK-3 | JAK3_HUMAN | JAKL | L-JAK | LJAK | Janus kinase 3 (a protein tyrosine kinase, leukocyte) | - | HPRD,BioGRID | 9047382 |10037026 |
| MAGEA12 | MAGE12 | melanoma antigen family A, 12 | Two-hybrid | BioGRID | 16189514 |
| MAPK1 | ERK | ERK2 | ERT1 | MAPK2 | P42MAPK | PRKM1 | PRKM2 | p38 | p40 | p41 | p41mapk | mitogen-activated protein kinase 1 | - | HPRD,BioGRID | 10194762 |10996427 |
| NCOR2 | CTG26 | SMRT | SMRTE | SMRTE-tau | TNRC14 | TRAC-1 | TRAC1 | nuclear receptor co-repressor 2 | - | HPRD | 11726519 |
| NMI | - | N-myc (and STAT) interactor | Nmi interacts with Stat5a | BIND | 9989503 |
| NMI | - | N-myc (and STAT) interactor | - | HPRD,BioGRID | 9989503 |
| NR3C1 | GCCR | GCR | GR | GRL | nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) | - | HPRD | 9528750 |
| PPIB | CYP-S1 | CYPB | MGC14109 | MGC2224 | SCYLP | peptidylprolyl isomerase B (cyclophilin B) | - | HPRD | 11997457 |
| PRTFDC1 | FLJ11888 | HHGP | phosphoribosyl transferase domain containing 1 | Two-hybrid | BioGRID | 16189514 |
| PTPN11 | BPTP3 | CFC | MGC14433 | NS1 | PTP-1D | PTP2C | SH-PTP2 | SH-PTP3 | SHP2 | protein tyrosine phosphatase, non-receptor type 11 | - | HPRD,BioGRID | 12060651 |
| SHC1 | FLJ26504 | SHC | SHCA | SHC (Src homology 2 domain containing) transforming protein 1 | Affinity Capture-Western | BioGRID | 10996427 |
| SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | - | HPRD | 10358079 |
| STAT5A | MGF | STAT5 | signal transducer and activator of transcription 5A | Phosphorylated STAT5a interacts with phosphorylated STAT5a to form a dimer. | BIND | 10594041 |
| STAT5A | MGF | STAT5 | signal transducer and activator of transcription 5A | - | HPRD | 9528750 |
| STAT5B | STAT5 | signal transducer and activator of transcription 5B | - | HPRD | 9528750 |
| SYK | DKFZp313N1010 | FLJ25043 | FLJ37489 | spleen tyrosine kinase | - | HPRD | 10825200 |
| TSLP | - | thymic stromal lymphopoietin | - | HPRD | 10570284 |11418668 |
Section V. Pathway annotation
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-141/200a | 1242 | 1248 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.