Gene Page: NR2F2
Summary ?
GeneID | 7026 |
Symbol | NR2F2 |
Synonyms | ARP1|CHTD4|COUPTFB|COUPTFII|NF-E3|NR2F1|SVP40|TFCOUP2 |
Description | nuclear receptor subfamily 2 group F member 2 |
Reference | MIM:107773|HGNC:HGNC:7976|Ensembl:ENSG00000185551|HPRD:00139|Vega:OTTHUMG00000149848 |
Gene type | protein-coding |
Map location | 15q26 |
Pascal p-value | 0.004 |
Sherlock p-value | 0.843 |
Fetal beta | 0.505 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 3 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 3 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg09738906 | 15 | 96875703 | NR2F2;MIR1469 | 8.35E-5 | -0.396 | 0.026 | DMG:Wockner_2014 |
cg08675869 | 15 | 96876737 | NR2F2 | 4.31E-8 | -0.015 | 1.19E-5 | DMG:Jaffe_2016 |
cg26920902 | 15 | 96960987 | NR2F2 | 6.03E-8 | -0.024 | 1.52E-5 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs7238856 | chr18 | 48746229 | NR2F2 | 7026 | 0.13 | trans | ||
rs7241194 | chr18 | 48750132 | NR2F2 | 7026 | 0.2 | trans | ||
rs4450500 | chr18 | 48780027 | NR2F2 | 7026 | 0.1 | trans | ||
rs16953013 | chr18 | 48780404 | NR2F2 | 7026 | 0.1 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0003706 | ligand-regulated transcription factor activity | TAS | 8530078 | |
GO:0003707 | steroid hormone receptor activity | IEA | - | |
GO:0003714 | transcription corepressor activity | TAS | 1899293 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001764 | neuron migration | IEA | neuron (GO term level: 8) | - |
GO:0030900 | forebrain development | IEA | Brain (GO term level: 8) | - |
GO:0007519 | skeletal muscle development | IEA | neuron (GO term level: 8) | - |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006357 | regulation of transcription from RNA polymerase II promoter | TAS | 1899293 | |
GO:0006350 | transcription | IEA | - | |
GO:0009956 | radial pattern formation | IEA | - | |
GO:0009952 | anterior/posterior pattern formation | IEA | - | |
GO:0007165 | signal transduction | TAS | 1899293 | |
GO:0006629 | lipid metabolic process | TAS | 1899293 | |
GO:0048514 | blood vessel morphogenesis | IEA | - | |
GO:0060173 | limb development | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005634 | nucleus | TAS | 1899293 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID TELOMERASE PATHWAY | 68 | 48 | All SZGR 2.0 genes in this pathway |
PID HNF3A PATHWAY | 44 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSCRIPTIONAL REGULATION OF WHITE ADIPOCYTE DIFFERENTIATION | 72 | 53 | All SZGR 2.0 genes in this pathway |
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA UP | 205 | 140 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
DAVICIONI RHABDOMYOSARCOMA PAX FOXO1 FUSION UP | 64 | 37 | All SZGR 2.0 genes in this pathway |
PUIFFE INVASION INHIBITED BY ASCITES UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
WANG CLIM2 TARGETS UP | 269 | 146 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 DN | 242 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 DN | 281 | 186 | All SZGR 2.0 genes in this pathway |
LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR DN | 209 | 122 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
BERENJENO ROCK SIGNALING NOT VIA RHOA DN | 48 | 34 | All SZGR 2.0 genes in this pathway |
WANG BARRETTS ESOPHAGUS UP | 51 | 27 | All SZGR 2.0 genes in this pathway |
STREICHER LSM1 TARGETS UP | 44 | 34 | All SZGR 2.0 genes in this pathway |
SCHLOSSER MYC TARGETS REPRESSED BY SERUM | 159 | 93 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM4 | 261 | 153 | All SZGR 2.0 genes in this pathway |
SCHLESINGER METHYLATED DE NOVO IN CANCER | 88 | 64 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
RANKIN ANGIOGENIC TARGETS OF VHL HIF2A DN | 8 | 7 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
WU CELL MIGRATION | 184 | 114 | All SZGR 2.0 genes in this pathway |
BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO IKK INHIBITOR AND TNF DN | 103 | 64 | All SZGR 2.0 genes in this pathway |
BECKER TAMOXIFEN RESISTANCE DN | 52 | 37 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN | 162 | 102 | All SZGR 2.0 genes in this pathway |
RADMACHER AML PROGNOSIS | 78 | 52 | All SZGR 2.0 genes in this pathway |
XU RESPONSE TO TRETINOIN DN | 13 | 8 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
PAL PRMT5 TARGETS UP | 203 | 135 | All SZGR 2.0 genes in this pathway |
RAMASWAMY METASTASIS DN | 61 | 47 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS UP | 175 | 116 | All SZGR 2.0 genes in this pathway |
KANG FLUOROURACIL RESISTANCE UP | 22 | 15 | All SZGR 2.0 genes in this pathway |
ZHU CMV 8 HR DN | 53 | 40 | All SZGR 2.0 genes in this pathway |
ZHU CMV ALL DN | 128 | 93 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
XU GH1 AUTOCRINE TARGETS DN | 142 | 94 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D8 | 40 | 29 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
HOWLIN CITED1 TARGETS 1 UP | 35 | 25 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS DN | 105 | 63 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS DN | 120 | 81 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING | 246 | 152 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
IZADPANAH STEM CELL ADIPOSE VS BONE UP | 126 | 92 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
HUPER BREAST BASAL VS LUMINAL DN | 59 | 44 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
VANASSE BCL2 TARGETS UP | 40 | 25 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS WITH HCP H3K27ME3 | 102 | 76 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS ICP WITH H3K27ME3 | 54 | 32 | All SZGR 2.0 genes in this pathway |
FONTAINE THYROID TUMOR UNCERTAIN MALIGNANCY UP | 36 | 23 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES HCP WITH H3K27ME3 | 41 | 30 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE DN | 103 | 67 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS GROWING | 243 | 155 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
HOELZEL NF1 TARGETS DN | 115 | 73 | All SZGR 2.0 genes in this pathway |
CARD MIR302A TARGETS | 77 | 62 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE VIA P38 PARTIAL | 160 | 106 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 1087 | 1093 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-144 | 1086 | 1093 | 1A,m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-150 | 331 | 338 | 1A,m8 | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
miR-155 | 195 | 201 | 1A | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
miR-194 | 99 | 105 | 1A | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
miR-30-5p | 1027 | 1033 | 1A | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-369-3p | 917 | 924 | 1A,m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 918 | 925 | 1A,m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-376c | 398 | 405 | 1A,m8 | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
miR-381 | 896 | 902 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU | ||||
miR-410 | 1134 | 1140 | m8 | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-431 | 799 | 805 | 1A | hsa-miR-431 | UGUCUUGCAGGCCGUCAUGCA |
miR-93.hd/291-3p/294/295/302/372/373/520 | 605 | 611 | 1A | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU | ||||
hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG | ||||
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.