Gene Page: KLF7
Summary ?
GeneID | 8609 |
Symbol | KLF7 |
Synonyms | UKLF |
Description | Kruppel-like factor 7 (ubiquitous) |
Reference | MIM:604865|HGNC:HGNC:6350|Ensembl:ENSG00000118263|HPRD:07279|Vega:OTTHUMG00000132935 |
Gene type | protein-coding |
Map location | 2q32 |
Pascal p-value | 0.057 |
Fetal beta | 1.132 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 3 |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 | |
Expression | Meta-analysis of gene expression | P value: 1.45 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg06728437 | 2 | 208031766 | KLF7 | 3.726E-4 | -0.406 | 0.043 | DMG:Wockner_2014 |
cg15474859 | 2 | 208030304 | KLF7 | 5.259E-4 | -0.221 | 0.048 | DMG:Wockner_2014 |
cg15058605 | 2 | 208031878 | KLF7 | 5.904E-4 | 0.278 | 0.05 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs5766004 | chr22 | 45180509 | KLF7 | 8609 | 0.18 | trans | ||
rs5766005 | chr22 | 45180553 | KLF7 | 8609 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
PCMT1 | 0.89 | 0.86 |
IQWD1 | 0.88 | 0.86 |
PROSC | 0.87 | 0.85 |
MOAP1 | 0.87 | 0.87 |
ARMCX3 | 0.87 | 0.83 |
NDEL1 | 0.87 | 0.85 |
PANK2 | 0.87 | 0.86 |
VAPB | 0.87 | 0.85 |
ARHGEF9 | 0.87 | 0.85 |
UQCC | 0.86 | 0.85 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.59 | -0.29 |
AF347015.18 | -0.57 | -0.33 |
IL32 | -0.53 | -0.33 |
AF347015.2 | -0.52 | -0.28 |
AC098691.2 | -0.52 | -0.41 |
AP002478.3 | -0.52 | -0.38 |
FXYD1 | -0.51 | -0.33 |
AF347015.8 | -0.51 | -0.28 |
MT-CO2 | -0.51 | -0.29 |
PLA2G5 | -0.50 | -0.32 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | TAS | 9774444 | |
GO:0003713 | transcription coactivator activity | TAS | 9774444 | |
GO:0008270 | zinc ion binding | TAS | 9774444 | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007411 | axon guidance | IEA | axon (GO term level: 13) | - |
GO:0048813 | dendrite morphogenesis | IEA | neurite, dendrite (GO term level: 12) | - |
GO:0006357 | regulation of transcription from RNA polymerase II promoter | TAS | 9774444 | |
GO:0006350 | transcription | IEA | - | |
GO:0045893 | positive regulation of transcription, DNA-dependent | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP | 285 | 181 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
RODRIGUES DCC TARGETS DN | 121 | 84 | All SZGR 2.0 genes in this pathway |
WANG CLIM2 TARGETS DN | 186 | 114 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS DN | 260 | 143 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA UP | 171 | 112 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA BY DMOG UP | 130 | 85 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS UP | 293 | 179 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 60 MCF10A | 39 | 24 | All SZGR 2.0 genes in this pathway |
AMIT SERUM RESPONSE 60 MCF10A | 57 | 42 | All SZGR 2.0 genes in this pathway |
GUO HEX TARGETS UP | 81 | 54 | All SZGR 2.0 genes in this pathway |
MENSE HYPOXIA UP | 98 | 71 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV SCC DN | 123 | 86 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
DAZARD UV RESPONSE CLUSTER G6 | 153 | 112 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS DN | 120 | 81 | All SZGR 2.0 genes in this pathway |
BEIER GLIOMA STEM CELL DN | 66 | 42 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C CLUSTER DN | 32 | 21 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C DN | 59 | 39 | All SZGR 2.0 genes in this pathway |
FERRARI RESPONSE TO FENRETINIDE UP | 22 | 16 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
MELLMAN TUT1 TARGETS DN | 47 | 29 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA PCA3 UP | 80 | 54 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-146 | 106 | 113 | 1A,m8 | hsa-miR-146a | UGAGAACUGAAUUCCAUGGGUU |
hsa-miR-146bbrain | UGAGAACUGAAUUCCAUAGGCU | ||||
miR-182 | 336 | 342 | m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.