SZGR2

Summary ?

GeneID	8609
Symbol	KLF7
Synonyms	UKLF
Description	Kruppel-like factor 7 (ubiquitous)
Reference	MIM:604865\|HGNC:HGNC:6350\|Ensembl:ENSG00000118263\|HPRD:07279\|Vega:OTTHUMG00000132935
Gene type	protein-coding
Map location	2q32
Pascal p-value	0.057
Fetal beta	1.132
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	3
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.01016
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00916
Expression	Meta-analysis of gene expression	P value: 1.45
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg06728437	2	208031766	KLF7	3.726E-4	-0.406	0.043	DMG:Wockner_2014
cg15474859	2	208030304	KLF7	5.259E-4	-0.221	0.048	DMG:Wockner_2014
cg15058605	2	208031878	KLF7	5.904E-4	0.278	0.05	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs5766004	chr22	45180509	KLF7	8609		0.18		trans
rs5766005	chr22	45180553	KLF7	8609		0.18		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PCMT1	0.89	0.86
IQWD1	0.88	0.86
PROSC	0.87	0.85
MOAP1	0.87	0.87
ARMCX3	0.87	0.83
NDEL1	0.87	0.85
PANK2	0.87	0.86
VAPB	0.87	0.85
ARHGEF9	0.87	0.85
UQCC	0.86	0.85

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.59	-0.29
AF347015.18	-0.57	-0.33
IL32	-0.53	-0.33
AF347015.2	-0.52	-0.28
AC098691.2	-0.52	-0.41
AP002478.3	-0.52	-0.38
FXYD1	-0.51	-0.33
AF347015.8	-0.51	-0.28
MT-CO2	-0.51	-0.29
PLA2G5	-0.50	-0.32

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	TAS		9774444
GO:0003713	transcription coactivator activity	TAS		9774444
GO:0008270	zinc ion binding	TAS		9774444
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007411	axon guidance	IEA	axon (GO term level: 13)	-
GO:0048813	dendrite morphogenesis	IEA	neurite, dendrite (GO term level: 12)	-
GO:0006357	regulation of transcription from RNA polymerase II promoter	TAS		9774444
GO:0006350	transcription	IEA		-
GO:0045893	positive regulation of transcription, DNA-dependent	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP	285	181	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP	332	228	All SZGR 2.0 genes in this pathway
RODRIGUES DCC TARGETS DN	121	84	All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS DN	186	114	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN	260	143	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN	329	219	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA UP	171	112	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA BY DMOG UP	130	85	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP	293	179	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN	382	224	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS	290	172	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 60 MCF10A	39	24	All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 60 MCF10A	57	42	All SZGR 2.0 genes in this pathway
GUO HEX TARGETS UP	81	54	All SZGR 2.0 genes in this pathway
MENSE HYPOXIA UP	98	71	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC DN	123	86	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6	153	112	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS UP	280	183	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5	482	296	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN	409	268	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN	120	81	All SZGR 2.0 genes in this pathway
BEIER GLIOMA STEM CELL DN	66	42	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C CLUSTER DN	32	21	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C DN	59	39	All SZGR 2.0 genes in this pathway
FERRARI RESPONSE TO FENRETINIDE UP	22	16	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN	435	289	All SZGR 2.0 genes in this pathway
MELLMAN TUT1 TARGETS DN	47	29	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN	442	275	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA3 UP	80	54	All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN	253	192	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR DN	254	158	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN	315	215	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE NOT VIA P38	337	236	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-146	106	113	1A,m8	hsa-miR-146a	UGAGAACUGAAUUCCAUGGGUU
miR-146	106	113	1A,m8	hsa-miR-146b^brain	UGAGAACUGAAUUCCAUAGGCU
miR-182	336	342	m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: KLF7