SZGR2

Summary ?

GeneID	8880
Symbol	FUBP1
Synonyms	FBP\|FUBP\|hDH V
Description	far upstream element binding protein 1
Reference	MIM:603444\|HGNC:HGNC:4004\|Ensembl:ENSG00000162613\|HPRD:10349\|Vega:OTTHUMG00000040799
Gene type	protein-coding
Map location	1p31.1
Pascal p-value	0.047
Sherlock p-value	0.605

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.02692

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
FUBP1	chr1	78430612	C	T	NM_003902	.	silent			Schizophrenia	DNM:Fromer_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CCK	0.81	0.86
VIP	0.80	0.89
RHEBL1	0.79	0.75
CA11	0.78	0.77
ITPKA	0.78	0.80
CASQ1	0.77	0.73
ENSA	0.77	0.68
ACOT4	0.77	0.78
ABCC12	0.76	0.87
RUNDC3A	0.76	0.70

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
FADS2	-0.53	-0.59
PDE9A	-0.52	-0.65
KIAA1949	-0.52	-0.56
TUBB2B	-0.51	-0.60
SH3BP2	-0.51	-0.64
PKN1	-0.51	-0.61
LIMK2	-0.51	-0.67
SEMA4B	-0.50	-0.57
FBLN1	-0.50	-0.62
ZNF792	-0.50	-0.57

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003697	single-stranded DNA binding	TAS		8125259
GO:0003700	transcription factor activity	TAS		8125259
GO:0003723	RNA binding	IEA		-
GO:0005515	protein binding	IPI		17353931
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
GO:0006366	transcription from RNA polymerase II promoter	TAS		8125259
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005730	nucleolus	IDA		18029348

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CCNH	CAK \| p34 \| p37	cyclin H	-	HPRD,BioGRID	11239393
CHD3	Mi-2a \| Mi2-ALPHA \| ZFH	chromodomain helicase DNA binding protein 3	Two-hybrid	BioGRID	16169070
CRMP1	DPYSL1 \| DRP-1 \| DRP1	collapsin response mediator protein 1	Two-hybrid	BioGRID	16169070
CUGBP1	BRUNOL2 \| CUG-BP \| CUGBP \| NAB50 \| hNab50	CUG triplet repeat, RNA binding protein 1	Two-hybrid	BioGRID	16169070
GTF2H1	BTF2 \| TFB1 \| TFIIH	general transcription factor IIH, polypeptide 1, 62kDa	-	HPRD,BioGRID	11239393
IMMT	DKFZp779P1653 \| HMP \| MGC111146 \| P87 \| P87/89 \| P89 \| PIG4 \| PIG52	inner membrane protein, mitochondrial (mitofilin)	-	HPRD	11239393
JTV1	AIMP2 \| P38 \| PRO0992	JTV1 gene	-	HPRD	12819782
KHSRP	FBP2 \| FUBP2 \| KSRP \| MGC99676	KH-type splicing regulatory protein	-	HPRD	11003644
MAPK14	CSBP1 \| CSBP2 \| CSPB1 \| EXIP \| Mxi2 \| PRKM14 \| PRKM15 \| RK \| SAPK2A \| p38 \| p38ALPHA	mitogen-activated protein kinase 14	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	12819782
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	FBP interacts with FUSE.	BIND	15502847
PUF60	FIR \| FLJ31379 \| RoBPI \| SIAHBP1	poly-U binding splicing factor 60KDa	-	HPRD	10882074
SMN1	BCD541 \| SMA \| SMA1 \| SMA2 \| SMA3 \| SMA4 \| SMA@ \| SMN \| SMNT \| T-BCD541	survival of motor neuron 1, telomeric	-	HPRD,BioGRID	10734235
SNCG	BCSG1 \| SR	synuclein, gamma (breast cancer-specific protein 1)	Affinity Capture-MS	BioGRID	17353931
TLE1	ESG \| ESG1 \| GRG1	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	Two-hybrid	BioGRID	16169070
VIM	FLJ36605	vimentin	Two-hybrid	BioGRID	16169070

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PYEON HPV POSITIVE TUMORS UP	98	47	All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS DN	309	191	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS DN	431	263	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN	663	425	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN	320	184	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP	372	227	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN	180	101	All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS DN	240	171	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN	459	276	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES CD4 DN	116	71	All SZGR 2.0 genes in this pathway
MARKEY RB1 ACUTE LOF DN	228	137	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN	770	415	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK DN	137	97	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
WANG HCP PROSTATE CANCER	111	69	All SZGR 2.0 genes in this pathway
PUJANA XPRSS INT NETWORK	168	103	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP	236	139	All SZGR 2.0 genes in this pathway
BENPORATH ES 1	379	235	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
GOLDRATH HOMEOSTATIC PROLIFERATION	171	102	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN	185	111	All SZGR 2.0 genes in this pathway
DER IFN BETA RESPONSE UP	102	67	All SZGR 2.0 genes in this pathway
PENG GLUCOSE DEPRIVATION DN	169	112	All SZGR 2.0 genes in this pathway
TAKAO RESPONSE TO UVB RADIATION UP	86	55	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR UP	225	139	All SZGR 2.0 genes in this pathway
MA PITUITARY FETAL VS ADULT UP	29	21	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 10HR UP	101	69	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
NICK RESPONSE TO PROC TREATMENT DN	27	18	All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE	200	115	All SZGR 2.0 genes in this pathway
ASGHARZADEH NEUROBLASTOMA POOR SURVIVAL DN	46	30	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 12HR UP	29	18	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 24HR DN	43	32	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 32HR DN	39	28	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 48HR DN	40	29	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 2	86	50	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN	336	211	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE	317	190	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF	367	231	All SZGR 2.0 genes in this pathway
DELACROIX RAR TARGETS DN	24	16	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP	279	155	All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP	289	184	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-132/212	755	761	m8	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	755	761	m8	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-15/16/195/424/497	700	707	1A,m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-155	648	654	1A	hsa-miR-155	UUAAUGCUAAUCGUGAUAGGGG
miR-199	480	486	m8	hsa-miR-199a	CCCAGUGUUCAGACUACCUGUUC
miR-199	480	486	m8	hsa-miR-199b	CCCAGUGUUUAGACUAUCUGUUC
miR-21	447	453	m8	hsa-miR-21^brain	UAGCUUAUCAGACUGAUGUUGA
miR-21	447	453	m8	hsa-miR-590	GAGCUUAUUCAUAAAAGUGCAG
miR-218	557	563	1A	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-503	701	707	1A	hsa-miR-503	UAGCAGCGGGAACAGUUCUGCAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: FUBP1