Gene Page: PRPF4B
Summary ?
| GeneID | 8899 |
| Symbol | PRPF4B |
| Synonyms | PR4H|PRP4|PRP4H|PRP4K|dJ1013A10.1 |
| Description | pre-mRNA processing factor 4B |
| Reference | MIM:602338|HGNC:HGNC:17346|Ensembl:ENSG00000112739|HPRD:09087|Vega:OTTHUMG00000014157 |
| Gene type | protein-coding |
| Map location | 6p25.2 |
| Pascal p-value | 0.02 |
| Sherlock p-value | 0.358 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0159 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| HSDL1 | 0.96 | 0.91 |
| CTTNBP2NL | 0.95 | 0.90 |
| CD24 | 0.95 | 0.89 |
| WDR40A | 0.95 | 0.93 |
| C2orf44 | 0.94 | 0.91 |
| GNG2 | 0.94 | 0.91 |
| KBTBD6 | 0.94 | 0.90 |
| SLAIN2 | 0.94 | 0.91 |
| ACLY | 0.94 | 0.90 |
| RBM12 | 0.94 | 0.92 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C5orf53 | -0.74 | -0.78 |
| HLA-F | -0.71 | -0.75 |
| AIFM3 | -0.69 | -0.72 |
| AF347015.27 | -0.69 | -0.84 |
| FBXO2 | -0.69 | -0.66 |
| MT-CO2 | -0.68 | -0.85 |
| AF347015.31 | -0.68 | -0.83 |
| S100B | -0.68 | -0.77 |
| AF347015.33 | -0.67 | -0.82 |
| FXYD1 | -0.67 | -0.82 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 15452250 |16169070 |17513757 |17620599 | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004672 | protein kinase activity | IEA | - | |
| GO:0004674 | protein serine/threonine kinase activity | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006397 | mRNA processing | IEA | - | |
| GO:0008380 | RNA splicing | TAS | 9102632 | |
| GO:0006468 | protein amino acid phosphorylation | IEA | - | |
| GO:0006468 | protein amino acid phosphorylation | TAS | 9102632 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005681 | spliceosome | IEA | - | |
| GO:0005694 | chromosome | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
| ELVIDGE HYPOXIA DN | 146 | 94 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS C UP | 170 | 114 | All SZGR 2.0 genes in this pathway |
| CHOI ATL STAGE PREDICTOR | 44 | 24 | All SZGR 2.0 genes in this pathway |
| XU HGF TARGETS INDUCED BY AKT1 48HR DN | 27 | 17 | All SZGR 2.0 genes in this pathway |
| DAUER STAT3 TARGETS DN | 50 | 34 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| SAKAI TUMOR INFILTRATING MONOCYTES DN | 81 | 51 | All SZGR 2.0 genes in this pathway |
| GOTTWEIN TARGETS OF KSHV MIR K12 11 | 63 | 45 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
| DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
| JI RESPONSE TO FSH DN | 58 | 43 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 14HR UP | 156 | 101 | All SZGR 2.0 genes in this pathway |
| DURCHDEWALD SKIN CARCINOGENESIS DN | 264 | 168 | All SZGR 2.0 genes in this pathway |
| LIN MELANOMA COPY NUMBER UP | 73 | 53 | All SZGR 2.0 genes in this pathway |
| FINETTI BREAST CANCERS KINOME GRAY | 15 | 10 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
| RAY TARGETS OF P210 BCR ABL FUSION UP | 18 | 13 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 36HR DN | 185 | 116 | All SZGR 2.0 genes in this pathway |
| BOYAULT LIVER CANCER SUBCLASS G1 UP | 113 | 70 | All SZGR 2.0 genes in this pathway |
| LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 752 | 758 | m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-103/107 | 2261 | 2268 | 1A,m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
| hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
| miR-132/212 | 4192 | 4198 | m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
| hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
| miR-138 | 1660 | 1666 | m8 | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
| miR-139 | 196 | 203 | 1A,m8 | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
| miR-142-5p | 799 | 806 | 1A,m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
| miR-146 | 1244 | 1250 | 1A | hsa-miR-146a | UGAGAACUGAAUUCCAUGGGUU |
| hsa-miR-146bbrain | UGAGAACUGAAUUCCAUAGGCU | ||||
| hsa-miR-146a | UGAGAACUGAAUUCCAUGGGUU | ||||
| hsa-miR-146bbrain | UGAGAACUGAAUUCCAUAGGCU | ||||
| miR-182 | 214 | 220 | m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-186 | 1093 | 1099 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| miR-21 | 533 | 539 | 1A | hsa-miR-21brain | UAGCUUAUCAGACUGAUGUUGA |
| hsa-miR-590 | GAGCUUAUUCAUAAAAGUGCAG | ||||
| miR-224 | 1140 | 1146 | m8 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
| miR-23 | 1137 | 1143 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
| hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
| miR-299-5p | 538 | 544 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-323 | 1137 | 1143 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
| miR-329 | 398 | 404 | m8 | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
| miR-335 | 1053 | 1059 | 1A | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
| miR-375 | 1058 | 1064 | 1A | hsa-miR-375 | UUUGUUCGUUCGGCUCGCGUGA |
| miR-377 | 630 | 636 | m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
| miR-494 | 1552 | 1558 | m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
| miR-495 | 812 | 818 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
| miR-539 | 1565 | 1571 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.