SZGR2

Summary ?

GeneID	9001
Symbol	HAP1
Synonyms	HAP2\|HIP5\|HLP\|hHLP1
Description	huntingtin-associated protein 1
Reference	MIM:600947\|HGNC:HGNC:4812\|Ensembl:ENSG00000173805\|HPRD:02972\|Vega:OTTHUMG00000133498
Gene type	protein-coding
Map location	17q21.2-q21.3
Pascal p-value	0.674
Sherlock p-value	0.128
Fetal beta	-0.604
eGene	Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0229

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
LRIG3	0.78	0.31
COL4A6	0.77	0.50
BOC	0.77	0.35
SOX3	0.75	0.32
NHLH1	0.75	0.40
MFAP2	0.74	0.43
TNFRSF19	0.74	0.47
VIM	0.74	0.42
GPC4	0.73	0.38
JUB	0.72	0.35

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C5orf53	-0.33	-0.34
AF347015.27	-0.31	-0.37
LGI4	-0.30	-0.23
AF347015.33	-0.30	-0.36
AC131097.1	-0.30	-0.38
AF347015.31	-0.29	-0.33
HLA-F	-0.29	-0.26
AF347015.8	-0.29	-0.35
MT-CO2	-0.29	-0.35
AIFM3	-0.28	-0.25

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003674	molecular_function	ND		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007268	synaptic transmission	TAS	neuron, Synap, Neurotransmitter (GO term level: 6)	9361024
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0015629	actin cytoskeleton	TAS		9361024

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ATP5J2	ATP5JL	ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2	Two-hybrid	BioGRID	16169070
BRD7	BP75 \| CELTIX1 \| NAG4	bromodomain containing 7	-	HPRD	15383276
C15orf29	FLJ22557 \| MGC117356	chromosome 15 open reading frame 29	Two-hybrid	BioGRID	16169070
C8orf33	FLJ20989	chromosome 8 open reading frame 33	Two-hybrid	BioGRID	16169070
CBX8	HPC3 \| PC3 \| RC1	chromobox homolog 8 (Pc class homolog, Drosophila)	Two-hybrid	BioGRID	16169070
CCDC113	DKFZp434N1418 \| FLJ23555 \| HSPC065	coiled-coil domain containing 113	Two-hybrid	BioGRID	16169070
CDK5RAP2	C48 \| Cep215 \| DKFZp686B1070 \| DKFZp686D1070 \| KIAA1633 \| MCPH3	CDK5 regulatory subunit associated protein 2	Two-hybrid	BioGRID	16169070
COL9A2	DJ39G22.4 \| EDM2 \| MED	collagen, type IX, alpha 2	Two-hybrid	BioGRID	16169070
CRIP1	CRHP \| CRIP \| CRP1 \| FLJ40971	cysteine-rich protein 1 (intestinal)	Two-hybrid	BioGRID	16169070
DCTN1	DAP-150 \| DP-150 \| HMN7B \| P135	dynactin 1 (p150, glued homolog, Drosophila)	-	HPRD,BioGRID	9361024 \|9454836
DDX49	FLJ10432 \| R27090_2	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	Two-hybrid	BioGRID	16169070
EIF3E	EIF3-P48 \| EIF3S6 \| INT6 \| eIF3-p46	eukaryotic translation initiation factor 3, subunit E	Two-hybrid	BioGRID	16169070
FAM173A	C16orf24 \| MGC2494	family with sequence similarity 173, member A	Two-hybrid	BioGRID	16169070
GLTSCR2	PICT-1 \| PICT1	glioma tumor suppressor candidate region gene 2	Two-hybrid	BioGRID	16169070
HAP1	HAP2 \| HIP5 \| HLP \| hHLP1	huntingtin-associated protein 1	-	HPRD,BioGRID	9798945
HGS	HRS \| ZFYVE8	hepatocyte growth factor-regulated tyrosine kinase substrate	-	HPRD,BioGRID	12021262
HMOX2	HO-2	heme oxygenase (decycling) 2	Two-hybrid	BioGRID	16169070
HTT	HD \| IT15	huntingtin	Affinity Capture-Western in vitro in vivo Reconstituted Complex Two-hybrid	BioGRID	7477378 \|9454836 \|9599014 \|9668110
HTT	HD \| IT15	huntingtin	Htt interacts with HAP1. This interaction was modeled on a demonstrated interaction between human Htt and Rat HAP1.	BIND	15654337
HTT	HD \| IT15	huntingtin	Huntingtin interacts with HAP1.	BIND	9668110
HTT	HD \| IT15	huntingtin	Htt interacts with Hap1.	BIND	7477378
HTT	HD \| IT15	huntingtin	-	HPRD	7477378 \|9599014 \|9668110 \|10974549
MPP3	DLG3	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	Two-hybrid	BioGRID	16169070
MRPS9	MRP-S9 \| RPMS9 \| S9mt	mitochondrial ribosomal protein S9	Two-hybrid	BioGRID	16169070
NAP1L5	DRLM	nucleosome assembly protein 1-like 5	Two-hybrid	BioGRID	16169070
NDUFB9	B22 \| DKFZp566O173 \| FLJ22885 \| LYRM3 \| UQOR22	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa	Two-hybrid	BioGRID	16169070
NEUROD1	BETA2 \| BHF-1 \| NEUROD \| bHLHa3	neurogenic differentiation 1	-	HPRD,BioGRID	12881483
NIPSNAP3A	DKFZp564D177 \| FLJ13953 \| HSPC299 \| MGC14553 \| NIPSNAP4 \| TASSC	nipsnap homolog 3A (C. elegans)	Two-hybrid	BioGRID	16169070
PCM1	PTC4	pericentriolar material 1	-	HPRD,BioGRID	9361024
PDCD7	ES18 \| HES18 \| MGC22015	programmed cell death 7	Two-hybrid	BioGRID	16169070
PFDN1	PDF \| PFD1	prefoldin subunit 1	Two-hybrid	BioGRID	16169070
PPID	CYP-40 \| CYPD \| MGC33096	peptidylprolyl isomerase D	Two-hybrid	BioGRID	16169070
PPOX	MGC8485 \| PPO \| V290M \| VP	protoporphyrinogen oxidase	Two-hybrid	BioGRID	16169070
PSMD11	MGC3844 \| Rpn6 \| S9 \| p44.5	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	Two-hybrid	BioGRID	16169070
RER1	-	RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)	Two-hybrid	BioGRID	16169070
RPS10	MGC88819	ribosomal protein S10	Two-hybrid	BioGRID	16169070
RPS25	-	ribosomal protein S25	Two-hybrid	BioGRID	16169070
SFRS4	SRP75	splicing factor, arginine/serine-rich 4	Two-hybrid	BioGRID	16169070
SNAPIN	SNAPAP	SNAP-associated protein	Two-hybrid	BioGRID	16169070
STX5	SED5 \| STX5A	syntaxin 5	Two-hybrid	BioGRID	16169070
TAF1D	JOSD3 \| MGC5306 \| TAF(I)41	TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa	Two-hybrid	BioGRID	16169070
TNNT3	AMCD2B \| DA2B \| DKFZp779M2348 \| FSSV	troponin T type 3 (skeletal, fast)	Two-hybrid	BioGRID	16169070
TOMM20	KIAA0016 \| MAS20 \| MGC117367 \| MOM19 \| TOM20	translocase of outer mitochondrial membrane 20 homolog (yeast)	Two-hybrid	BioGRID	16169070
TSPYL1	TSPYL	TSPY-like 1	Two-hybrid	BioGRID	16169070
UTP3	CRL1 \| CRLZ1 \| FLJ23256 \| SAS10	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	Two-hybrid	BioGRID	16169070
ZNF20	FLJ39241 \| KOX13	zinc finger protein 20	Two-hybrid	BioGRID	16169070
ZNF24	KOX17 \| RSG-A \| ZNF191 \| ZSCAN3 \| Zfp191	zinc finger protein 24	Two-hybrid	BioGRID	16169070
ZNF691	RP11-342M1.5 \| Zfp691	zinc finger protein 691	Two-hybrid	BioGRID	16169070

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG HUNTINGTONS DISEASE	185	109	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
LI LUNG CANCER	41	30	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS DN	57	39	All SZGR 2.0 genes in this pathway
LEIN MIDBRAIN MARKERS	82	55	All SZGR 2.0 genes in this pathway
CAMPS COLON CANCER COPY NUMBER UP	92	45	All SZGR 2.0 genes in this pathway
WINTER HYPOXIA METAGENE	242	168	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP	491	316	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
ASGHARZADEH NEUROBLASTOMA POOR SURVIVAL DN	46	30	All SZGR 2.0 genes in this pathway
BILANGES RAPAMYCIN SENSITIVE GENES	39	20	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-328	405	411	m8	hsa-miR-328^brain	CUGGCCCUCUCUGCCCUUCCGU
miR-339	402	408	m8	hsa-miR-339	UCCCUGUCCUCCAGGAGCUCA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: HAP1