Gene Page: LHX2
Summary ?
GeneID | 9355 |
Symbol | LHX2 |
Synonyms | LH2|hLhx2 |
Description | LIM homeobox 2 |
Reference | MIM:603759|HGNC:HGNC:6594|Ensembl:ENSG00000106689|HPRD:04786|Vega:OTTHUMG00000020647 |
Gene type | protein-coding |
Map location | 9q33.3 |
Pascal p-value | 0.329 |
Sherlock p-value | 0.978 |
Fetal beta | 1.033 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg14425564 | 9 | 126794772 | LHX2 | 5.61E-5 | 0.335 | 0.022 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007420 | brain development | IEA | Brain (GO term level: 7) | - |
GO:0007399 | nervous system development | IEA | neurite (GO term level: 5) | - |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0009953 | dorsal/ventral pattern formation | IEA | - | |
GO:0007498 | mesoderm development | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
LEE NEURAL CREST STEM CELL DN | 118 | 79 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
DACOSTA ERCC3 ALLELE XPCS VS TTD UP | 28 | 19 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
JAZAG TGFB1 SIGNALING VIA SMAD4 UP | 108 | 66 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
CERVERA SDHB TARGETS 1 UP | 118 | 66 | All SZGR 2.0 genes in this pathway |
POMEROY MEDULLOBLASTOMA DESMOPLASIC VS CLASSIC UP | 62 | 38 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
SATO SILENCED EPIGENETICALLY IN PANCREATIC CANCER | 49 | 30 | All SZGR 2.0 genes in this pathway |
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 | 473 | 224 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON UP | 77 | 47 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
SHARMA PILOCYTIC ASTROCYTOMA LOCATION UP | 25 | 12 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA1 DN | 74 | 47 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 306 | 312 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 305 | 312 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-144 | 316 | 322 | m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-186 | 27 | 33 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-34/449 | 297 | 303 | 1A | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-495 | 429 | 436 | 1A,m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
miR-496 | 399 | 405 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.