Gene Page: CDYL
Summary ?
GeneID | 9425 |
Symbol | CDYL |
Synonyms | CDYL1 |
Description | chromodomain protein, Y-like |
Reference | MIM:603778|HGNC:HGNC:1811|Ensembl:ENSG00000153046|HPRD:04803|Vega:OTTHUMG00000014170 |
Gene type | protein-coding |
Map location | 6p25.1 |
Pascal p-value | 0.011 |
Sherlock p-value | 0.833 |
eGene | Hippocampus |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0159 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SEMA4C | 0.96 | 0.96 |
ZNF746 | 0.96 | 0.95 |
NUP62 | 0.96 | 0.97 |
ZNF317 | 0.95 | 0.94 |
SF1 | 0.95 | 0.96 |
KDM4A | 0.95 | 0.94 |
EDC3 | 0.95 | 0.92 |
QRICH1 | 0.95 | 0.94 |
KDM2B | 0.95 | 0.95 |
CSNK1E | 0.95 | 0.93 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.79 | -0.90 |
MT-CO2 | -0.77 | -0.90 |
C5orf53 | -0.76 | -0.78 |
AF347015.27 | -0.75 | -0.87 |
AF347015.33 | -0.74 | -0.85 |
IFI27 | -0.74 | -0.85 |
FXYD1 | -0.74 | -0.85 |
MT-CYB | -0.74 | -0.86 |
S100B | -0.73 | -0.81 |
AF347015.8 | -0.73 | -0.88 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003682 | chromatin binding | IEA | - | |
GO:0004402 | histone acetyltransferase activity | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
GO:0008415 | acyltransferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006333 | chromatin assembly or disassembly | IEA | - | |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
GO:0007283 | spermatogenesis | TAS | 10192397 | |
GO:0008152 | metabolic process | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000785 | chromatin | IEA | - | |
GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
BIDUS METASTASIS UP | 214 | 134 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
BEGUM TARGETS OF PAX3 FOXO1 FUSION UP | 60 | 45 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BENPORATH NOS TARGETS | 179 | 105 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 480 HELA | 164 | 118 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV SCC DN | 123 | 86 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
DAZARD UV RESPONSE CLUSTER G6 | 153 | 112 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D8 | 40 | 29 | All SZGR 2.0 genes in this pathway |
LIN MELANOMA COPY NUMBER UP | 73 | 53 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
ALONSO METASTASIS UP | 198 | 128 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
GYORFFY DOXORUBICIN RESISTANCE | 56 | 34 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
LIU IL13 PRIMING MODEL | 15 | 11 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 501 | 507 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-101 | 167 | 174 | 1A,m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-144 | 168 | 174 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-181 | 1216 | 1223 | 1A,m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-196 | 1031 | 1037 | m8 | hsa-miR-196a | UAGGUAGUUUCAUGUUGUUGG |
hsa-miR-196b | UAGGUAGUUUCCUGUUGUUGG | ||||
miR-200bc/429 | 1350 | 1356 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-27 | 1448 | 1454 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-329 | 1314 | 1320 | 1A | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
miR-370 | 39 | 45 | 1A | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
miR-485-3p | 1220 | 1227 | 1A,m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
miR-495 | 372 | 378 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.