Gene Page: PDE4DIP
Summary ?
GeneID | 9659 |
Symbol | PDE4DIP |
Synonyms | CMYA2|MMGL |
Description | phosphodiesterase 4D interacting protein |
Reference | MIM:608117|HGNC:HGNC:15580|Ensembl:ENSG00000178104|HPRD:10482|Vega:OTTHUMG00000013846 |
Gene type | protein-coding |
Map location | 1q12 |
Fetal beta | -1.838 |
Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CNV:YES | Copy number variation studies | Manual curation | |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
PDE4DIP | chr1 | 144931128 | A | C | NM_001002811 NM_001002812 NM_001198832 NM_001198834 NM_014644 | p.194I>S . . . . | missense intronic intronic intronic intronic | Schizophrenia | DNM:Fromer_2014 | ||
PDE4DIP | chr1 | 144931615 | G | A | NM_001002811 NM_001002812 NM_001198832 NM_001198834 NM_014644 | . . . . . | silent intronic intronic intronic intronic | Schizophrenia | DNM:Xu_2012 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003779 | actin binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007010 | cytoskeleton organization | IEA | - | |
GO:0030036 | actin cytoskeleton organization | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005794 | Golgi apparatus | IEA | - | |
GO:0005813 | centrosome | IEA | - | |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0015629 | actin cytoskeleton | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST NORMAL DUCTAL VS LOBULAR UP | 68 | 40 | All SZGR 2.0 genes in this pathway |
LIU VMYB TARGETS UP | 127 | 78 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP | 85 | 54 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D DN | 142 | 90 | All SZGR 2.0 genes in this pathway |
AKL HTLV1 INFECTION DN | 68 | 41 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
BIDUS METASTASIS DN | 161 | 93 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
PEREZ TP63 TARGETS | 355 | 243 | All SZGR 2.0 genes in this pathway |
HATADA METHYLATED IN LUNG CANCER UP | 390 | 236 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 1 UP | 140 | 85 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
YAGI AML SURVIVAL | 129 | 87 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM | 302 | 191 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
MCDOWELL ACUTE LUNG INJURY DN | 48 | 33 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY GAMMA RADIATION | 81 | 59 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION UP | 282 | 183 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
MCCABE HOXC6 TARGETS UP | 10 | 8 | All SZGR 2.0 genes in this pathway |
MCCABE HOXC6 TARGETS CANCER UP | 31 | 23 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER WITH H3K27ME3 DN | 228 | 114 | All SZGR 2.0 genes in this pathway |
ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE UP | 97 | 61 | All SZGR 2.0 genes in this pathway |
BASSO HAIRY CELL LEUKEMIA DN | 80 | 66 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL UP | 260 | 174 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA1 UP | 76 | 46 | All SZGR 2.0 genes in this pathway |
MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
GREGORY SYNTHETIC LETHAL WITH IMATINIB | 145 | 83 | All SZGR 2.0 genes in this pathway |
JUBAN TARGETS OF SPI1 AND FLI1 DN | 92 | 60 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR UP | 199 | 143 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-183 | 1615 | 1621 | 1A | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.