Gene Page: SPOCK2
Summary ?
GeneID | 9806 |
Symbol | SPOCK2 |
Synonyms | testican-2 |
Description | sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 |
Reference | MIM:607988|HGNC:HGNC:13564|Ensembl:ENSG00000107742|HPRD:12146|Vega:OTTHUMG00000018430 |
Gene type | protein-coding |
Map location | 10pter-q25.3 |
Pascal p-value | 0.034 |
Sherlock p-value | 0.015 |
Fetal beta | -3.603 |
DMG | 1 (# studies) |
eGene | Cerebellar Hemisphere Cerebellum |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg09661010 | 10 | 73848153 | SPOCK2 | 3.45E-8 | -0.013 | 1.02E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
CUL1 | 0.95 | 0.95 |
CLPX | 0.94 | 0.94 |
FBXO11 | 0.93 | 0.95 |
STRN3 | 0.93 | 0.94 |
ZC3H14 | 0.93 | 0.94 |
CUL3 | 0.93 | 0.94 |
YME1L1 | 0.92 | 0.94 |
FBXO38 | 0.92 | 0.92 |
ELP3 | 0.92 | 0.91 |
LSG1 | 0.92 | 0.93 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MT-CO2 | -0.82 | -0.85 |
AF347015.31 | -0.81 | -0.84 |
IFI27 | -0.79 | -0.84 |
AF347015.21 | -0.79 | -0.82 |
HIGD1B | -0.78 | -0.81 |
MT-CYB | -0.78 | -0.80 |
AF347015.8 | -0.78 | -0.82 |
FXYD1 | -0.77 | -0.82 |
AF347015.33 | -0.77 | -0.80 |
AF347015.27 | -0.76 | -0.80 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005509 | calcium ion binding | IDA | 10386950 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007416 | synaptogenesis | NAS | Synap (GO term level: 6) | 10386950 |
GO:0030198 | extracellular matrix organization | NAS | 10386950 | |
GO:0045595 | regulation of cell differentiation | NAS | 10386950 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0005578 | proteinaceous extracellular matrix | NAS | 10386950 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS DN | 68 | 49 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 8HR DN | 129 | 84 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER LMP DN | 199 | 124 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
CHEBOTAEV GR TARGETS UP | 77 | 62 | All SZGR 2.0 genes in this pathway |
KANG GIST WITH PDGFRA UP | 50 | 27 | All SZGR 2.0 genes in this pathway |
HATADA METHYLATED IN LUNG CANCER UP | 390 | 236 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
LEE TARGETS OF PTCH1 AND SUFU DN | 83 | 69 | All SZGR 2.0 genes in this pathway |
CHEOK RESPONSE TO MERCAPTOPURINE DN | 22 | 15 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE UP | 203 | 130 | All SZGR 2.0 genes in this pathway |
FERRANDO T ALL WITH MLL ENL FUSION UP | 87 | 67 | All SZGR 2.0 genes in this pathway |
MCCLUNG COCAINE REWARD 5D | 79 | 62 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P3 | 160 | 103 | All SZGR 2.0 genes in this pathway |
ZHANG GATA6 TARGETS DN | 64 | 46 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
LIN NPAS4 TARGETS UP | 163 | 100 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
GUTIERREZ CHRONIC LYMPHOCYTIC LEUKEMIA DN | 56 | 39 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 7 | 76 | 46 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
NABA PROTEOGLYCANS | 35 | 23 | All SZGR 2.0 genes in this pathway |
NABA CORE MATRISOME | 275 | 148 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 2925 | 2931 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-141/200a | 3484 | 3490 | 1A | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-142-5p | 3712 | 3719 | 1A,m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-26 | 2168 | 2175 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-543 | 3681 | 3687 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.