Gene Page: PLXNC1
Summary ?
| GeneID | 10154 |
| Symbol | PLXNC1 |
| Synonyms | CD232|PLXN-C1|VESPR |
| Description | plexin C1 |
| Reference | MIM:604259|HGNC:HGNC:9106|Ensembl:ENSG00000136040|HPRD:05036|Vega:OTTHUMG00000170235 |
| Gene type | protein-coding |
| Map location | 12q23.3 |
| Pascal p-value | 0.117 |
| Fetal beta | 0.942 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg04048411 | 12 | 94541943 | PLXNC1 | 3.2E-4 | -0.338 | 0.04 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs10777641 | chr12 | 95252883 | PLXNC1 | 10154 | 0.18 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| SCYL1 | 0.91 | 0.88 |
| C11orf68 | 0.90 | 0.86 |
| EPN1 | 0.89 | 0.88 |
| C7orf20 | 0.89 | 0.85 |
| TAF6 | 0.89 | 0.86 |
| APBB1 | 0.88 | 0.86 |
| FBXW5 | 0.88 | 0.86 |
| AGAP3 | 0.88 | 0.84 |
| FARSA | 0.88 | 0.82 |
| TCF25 | 0.88 | 0.83 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.21 | -0.74 | -0.61 |
| AF347015.8 | -0.71 | -0.57 |
| MT-CO2 | -0.71 | -0.57 |
| AF347015.31 | -0.70 | -0.57 |
| AF347015.2 | -0.69 | -0.52 |
| AL139819.3 | -0.69 | -0.68 |
| MT-CYB | -0.69 | -0.55 |
| AF347015.26 | -0.68 | -0.53 |
| AF347015.33 | -0.68 | -0.55 |
| AF347015.18 | -0.68 | -0.58 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005102 | receptor binding | TAS | Neurotransmitter (GO term level: 4) | 9586637 |
| GO:0004872 | receptor activity | IEA | - | |
| GO:0004867 | serine-type endopeptidase inhibitor activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007155 | cell adhesion | TAS | 9586637 | |
| GO:0007165 | signal transduction | IEA | - | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0005886 | plasma membrane | NAS | 9586637 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
| REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
| REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
| REACTOME OTHER SEMAPHORIN INTERACTIONS | 15 | 14 | All SZGR 2.0 genes in this pathway |
| REACTOME SEMAPHORIN INTERACTIONS | 68 | 53 | All SZGR 2.0 genes in this pathway |
| ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
| SCHUETZ BREAST CANCER DUCTAL INVASIVE UP | 351 | 230 | All SZGR 2.0 genes in this pathway |
| DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
| TURASHVILI BREAST LOBULAR CARCINOMA VS DUCTAL NORMAL UP | 69 | 38 | All SZGR 2.0 genes in this pathway |
| HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| RODRIGUES NTN1 TARGETS UP | 17 | 11 | All SZGR 2.0 genes in this pathway |
| JAEGER METASTASIS DN | 258 | 141 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
| TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN | 187 | 115 | All SZGR 2.0 genes in this pathway |
| TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE DN | 54 | 38 | All SZGR 2.0 genes in this pathway |
| TONKS TARGETS OF RUNX1 RUNX1T1 FUSION SUSTAINED IN MONOCYTE DN | 8 | 7 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
| WANG ESOPHAGUS CANCER VS NORMAL DN | 101 | 66 | All SZGR 2.0 genes in this pathway |
| HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
| BEGUM TARGETS OF PAX3 FOXO1 FUSION UP | 60 | 45 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM4 | 261 | 153 | All SZGR 2.0 genes in this pathway |
| LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
| ALCALAY AML BY NPM1 LOCALIZATION DN | 184 | 132 | All SZGR 2.0 genes in this pathway |
| BASSO CD40 SIGNALING UP | 101 | 76 | All SZGR 2.0 genes in this pathway |
| REN ALVEOLAR RHABDOMYOSARCOMA UP | 98 | 64 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
| JI RESPONSE TO FSH UP | 74 | 56 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 | 473 | 224 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
| BASSO HAIRY CELL LEUKEMIA DN | 80 | 66 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
| QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
| FRASOR RESPONSE TO SERM OR FULVESTRANT UP | 24 | 14 | All SZGR 2.0 genes in this pathway |
| VANASSE BCL2 TARGETS DN | 74 | 50 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| CAIRO HEPATOBLASTOMA UP | 207 | 143 | All SZGR 2.0 genes in this pathway |
| GUTIERREZ CHRONIC LYMPHOCYTIC LEUKEMIA UP | 12 | 5 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN | 321 | 200 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| KATSANOU ELAVL1 TARGETS DN | 148 | 88 | All SZGR 2.0 genes in this pathway |
| NABA ECM AFFILIATED | 171 | 89 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-150 | 45 | 51 | m8 | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
| miR-19 | 93 | 100 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-320 | 149 | 155 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.