SZGR2

Summary ?

GeneID	10409
Symbol	BASP1
Synonyms	CAP-23\|CAP23\|NAP-22\|NAP22
Description	brain abundant membrane attached signal protein 1
Reference	MIM:605940\|HGNC:HGNC:957\|Ensembl:ENSG00000176788\|HPRD:08389\|Vega:OTTHUMG00000131061
Gene type	protein-coding
Map location	5p15.1
Pascal p-value	0.043
Sherlock p-value	0.953
Fetal beta	0.711
DMG	1 (# studies)
Support	INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg04713453	5	17217093	BASP1	7.54E-9	-0.026	3.72E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TSG101	0.92	0.93
ESD	0.92	0.93
EIF3M	0.91	0.92
CNOT10	0.90	0.91
IFT52	0.90	0.93
GTF2B	0.90	0.90
MRPL45	0.90	0.90
MMADHC	0.90	0.91
DAP3	0.90	0.90
CCT4	0.89	0.92

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.8	-0.76	-0.82
MT-CYB	-0.76	-0.83
AF347015.27	-0.76	-0.81
MT-CO2	-0.75	-0.80
AF347015.33	-0.75	-0.82
AF347015.15	-0.75	-0.83
AF347015.2	-0.75	-0.83
AF347015.26	-0.75	-0.84
AF347015.31	-0.73	-0.78
HLA-F	-0.69	-0.75

Section III. Gene Ontology annotation

Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0042995	cell projection	IEA	axon (GO term level: 4)	-
GO:0005856	cytoskeleton	TAS		9749536
GO:0005886	plasma membrane	TAS		9749536

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
HOLLMANN APOPTOSIS VIA CD40 UP	201	125	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA DN	349	157	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS TOP50 UP	38	27	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS DN	431	263	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL UP	95	64	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP DN	199	124	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 DN	67	43	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
ODONNELL METASTASIS UP	82	58	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 3 4WK UP	214	144	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS UP	169	127	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION HBZ	41	27	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 4	61	34	All SZGR 2.0 genes in this pathway
LUI THYROID CANCER CLUSTER 2	42	31	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP	769	437	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
SCIAN INVERSED TARGETS OF TP53 AND TP73 DN	31	23	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR DN	57	45	All SZGR 2.0 genes in this pathway
SCHAEFFER SOX9 TARGETS IN PROSTATE DEVELOPMENT DN	45	33	All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE UP	283	177	All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS UP	108	75	All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE UP	203	130	All SZGR 2.0 genes in this pathway
NADLER OBESITY UP	61	34	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN	366	238	All SZGR 2.0 genes in this pathway
LEI MYB TARGETS	318	215	All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED UP	183	111	All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN	162	102	All SZGR 2.0 genes in this pathway
NGUYEN NOTCH1 TARGETS DN	86	67	All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION	405	264	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
DELASERNA MYOD TARGETS DN	57	42	All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS UP	100	72	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN	220	147	All SZGR 2.0 genes in this pathway
STEARMAN LUNG CANCER EARLY VS LATE DN	61	39	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 2D DN	64	35	All SZGR 2.0 genes in this pathway
ENGELMANN CANCER PROGENITORS UP	48	31	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP	439	257	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP	260	174	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA DN	100	63	All SZGR 2.0 genes in this pathway
BEIER GLIOMA STEM CELL DN	66	42	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D DN	252	155	All SZGR 2.0 genes in this pathway
VANASSE BCL2 TARGETS UP	40	25	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP	491	316	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN	442	275	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12	317	177	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3 UNMETHYLATED	536	296	All SZGR 2.0 genes in this pathway
CROONQUIST STROMAL STIMULATION UP	60	42	All SZGR 2.0 genes in this pathway
CROONQUIST NRAS VS STROMAL STIMULATION DN	99	65	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 15	31	19	All SZGR 2.0 genes in this pathway
VALK AML WITH CEBPA	37	27	All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 DN	170	105	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME2	17	11	All SZGR 2.0 genes in this pathway
MARSON FOXP3 TARGETS UP	66	43	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA1 UP	101	66	All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT UP	166	105	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA LB DN	44	23	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS UP	221	135	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3 UNMETHYLATED	228	119	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 5	30	22	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA NEURAL	129	85	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 UP	140	94	All SZGR 2.0 genes in this pathway
VANDESLUIS NORMAL EMBRYOS DN	25	13	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway
ROESSLER LIVER CANCER METASTASIS UP	107	72	All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP	289	184	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-150	618	624	m8	hsa-miR-150	UCUCCCAACCCUUGUACCAGUG
miR-200bc/429	465	471	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-324-5p	866	872	1A	hsa-miR-324-5p	CGCAUCCCCUAGGGCAUUGGUGU
miR-381	889	895	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-409-3p	630	636	m8	hsa-miR-409-3p	CGAAUGUUGCUCGGUGAACCCCU
miR-493-5p	857	864	1A,m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-539	661	668	1A,m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU
miR-7	780	786	1A	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: BASP1