SZGR2

Summary ?

GeneID	10755
Symbol	GIPC1
Synonyms	C19orf3\|GIPC\|GLUT1CBP\|Hs.6454\|IIP-1\|NIP\|RGS19IP1\|SEMCAP\|SYNECTIIN\|SYNECTIN\|TIP-2
Description	GIPC PDZ domain containing family member 1
Reference	MIM:605072\|HGNC:HGNC:1226\|Ensembl:ENSG00000123159\|HPRD:05462\|Vega:OTTHUMG00000182248
Gene type	protein-coding
Map location	19p13.1
Pascal p-value	0.019
Sherlock p-value	0.731
Fetal beta	-1.127
eGene	Myers' cis & trans
Support	G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 7
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.7595

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs7729934	chr5	136104636	GIPC1	10755		0.18		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005102	receptor binding	IPI	Neurotransmitter (GO term level: 4)	15459234
GO:0003779	actin binding	IEA		-
GO:0017022	myosin binding	IEA		-
GO:0042803	protein homodimerization activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007268	synaptic transmission	IEA	neuron, Synap, Neurotransmitter (GO term level: 6)	-
GO:0014047	glutamate secretion	IEA	glutamate, Neurotransmitter (GO term level: 7)	-
GO:0048167	regulation of synaptic plasticity	IEA	Synap (GO term level: 8)	-
GO:0007186	G-protein coupled receptor protein signaling pathway	NAS		9770488
GO:0006605	protein targeting	IEA		-
GO:0030511	positive regulation of transforming growth factor beta receptor signaling pathway	ISS		-
GO:0032435	negative regulation of proteasomal ubiquitin-dependent protein catabolic process	ISS		-
GO:0031647	regulation of protein stability	ISS		-
GO:0043542	endothelial cell migration	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008021	synaptic vesicle	IEA	Synap, Neurotransmitter (GO term level: 12)	-
GO:0043198	dendritic shaft	IEA	dendrite (GO term level: 7)	-
GO:0043197	dendritic spine	IEA	Synap, dendrite (GO term level: 7)	-
GO:0012506	vesicle membrane	IEA		-
GO:0005829	cytosol	ISS		-
GO:0005624	membrane fraction	IDA		9770488
GO:0005625	soluble fraction	IDA		9770488
GO:0005737	cytoplasm	IEA		-
GO:0016020	membrane	ISS		-
GO:0016023	cytoplasmic membrane-bounded vesicle	IDA		12857860
GO:0005938	cell cortex	IDA		12857860

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTN1	FLJ40884	actinin, alpha 1	Affinity Capture-Western Reconstituted Complex	BioGRID	10198040
ADRB1	ADRB1R \| B1AR \| BETA1AR \| RHR	adrenergic, beta-1-, receptor	Affinity Capture-Western Two-hybrid	BioGRID	12724327
ADRB1	ADRB1R \| B1AR \| BETA1AR \| RHR	adrenergic, beta-1-, receptor	The carboxy terminus of beta-1-AR interacts with GIPC.	BIND	12724327
CD93	C1QR1 \| C1qR(P) \| C1qRP \| CDw93 \| MXRA4 \| dJ737E23.1	CD93 molecule	CD93 interacts with GIPC.	BIND	15459234
CD93	C1QR1 \| C1qR(P) \| C1qRP \| CDw93 \| MXRA4 \| dJ737E23.1	CD93 molecule	GIPC interacts with CD93. This interaction was modelled on a demonstrated interaction between GIPC from an unspecified species and human CD93.	BIND	15819698
DRD3	D3DR \| ETM1 \| FET1 \| MGC149204 \| MGC149205	dopamine receptor D3	Two-hybrid	BioGRID	14499480
GEMIN4	DKFZp434B131 \| DKFZp434D174 \| HC56 \| HCAP1 \| HHRF-1 \| p97	gem (nuclear organelle) associated protein 4	Affinity Capture-MS	BioGRID	17353931
ITGA5	CD49e \| FNRA \| VLA5A	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	-	HPRD,BioGRID	11479315
ITGA6	CD49f \| DKFZp686J01244 \| FLJ18737 \| ITGA6B \| VLA-6	integrin, alpha 6	-	HPRD,BioGRID	11479315
KIF1B	CMT2 \| CMT2A \| CMT2A1 \| FLJ23699 \| HMSNII \| KIAA0591 \| KIAA1448 \| KLP \| MGC134844	kinesin family member 1B	-	HPRD,BioGRID	10198040
LHCGR	FLJ41504 \| LCGR \| LGR2 \| LH/CG-R \| LH/CGR \| LHR \| LHRHR \| LSH-R	luteinizing hormone/choriogonadotropin receptor	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	14507927
LHCGR	FLJ41504 \| LCGR \| LGR2 \| LH/CG-R \| LH/CGR \| LHR \| LHRHR \| LSH-R	luteinizing hormone/choriogonadotropin receptor	GIPC interacts with hLHR.	BIND	14507927
LRP1	A2MR \| APOER \| APR \| CD91 \| FLJ16451 \| IGFBP3R \| LRP \| MGC88725 \| TGFBR5	low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor)	Reconstituted Complex Two-hybrid	BioGRID	10827173
LRP2	DBS \| gp330	low density lipoprotein-related protein 2	-	HPRD,BioGRID	11912251
LRP8	APOER2 \| HSZ75190 \| MCI1	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	Two-hybrid	BioGRID	10827173
MARS	FLJ35667 \| METRS \| MTRNS	methionyl-tRNA synthetase	Affinity Capture-MS	BioGRID	17353931
MCM7	CDABP0042 \| CDC47 \| MCM2 \| P1.1-MCM3 \| P1CDC47 \| P85MCM \| PNAS-146	minichromosome maintenance complex component 7	Affinity Capture-MS	BioGRID	17353931
MMS19	FLJ34167 \| FLJ95146 \| MET18 \| MGC99604 \| MMS19L \| hMMS19	MMS19 nucleotide excision repair homolog (S. cerevisiae)	Affinity Capture-MS	BioGRID	17353931
MYO1C	FLJ23903 \| MMI-beta \| MMIb \| NMI \| myr2	myosin IC	Affinity Capture-MS	BioGRID	17353931
MYO6	DFNA22 \| DFNB37 \| KIAA0389	myosin VI	-	HPRD	12857860 \|12893809
MYO6	DFNA22 \| DFNB37 \| KIAA0389	myosin VI	Affinity Capture-MS Affinity Capture-Western	BioGRID	12857860 \|17353931
NTRK1	DKFZp781I14186 \| MTC \| TRK \| TRK1 \| TRKA \| p140-TrkA	neurotrophic tyrosine kinase, receptor, type 1	GIPC interacts with TRKA. This interaction was modelled on a demonstrated interaction between mouse GIPC and rat TrkA.	BIND	11251075
NTRK1	DKFZp781I14186 \| MTC \| TRK \| TRK1 \| TRKA \| p140-TrkA	neurotrophic tyrosine kinase, receptor, type 1	-	HPRD,BioGRID	11251075
NTRK2	GP145-TrkB \| TRKB	neurotrophic tyrosine kinase, receptor, type 2	-	HPRD,BioGRID	11251075
NUP93	KIAA0095 \| MGC21106	nucleoporin 93kDa	Affinity Capture-MS	BioGRID	17353931
PDXDC1	KIAA0251 \| LP8165	pyridoxal-dependent decarboxylase domain containing 1	Affinity Capture-MS	BioGRID	17353931
RGS1	1R20 \| BL34 \| IER1 \| IR20	regulator of G-protein signaling 1	-	HPRD	11251075
RGS19	GAIP \| RGSGAIP	regulator of G-protein signaling 19	GAIP interacts with GIPC. This interaction was modelled on a demonstrated interaction between human GAIP and mouse GIPC.	BIND	11251075
RGS19	GAIP \| RGSGAIP	regulator of G-protein signaling 19	-	HPRD,BioGRID	9770488 \|11251075 \|11956658
SDC4	MGC22217 \| SYND4	syndecan 4	Affinity Capture-Western	BioGRID	10911369
SEMA4C	FLJ20369 \| KIAA1739 \| M-SEMA-F \| MGC126382 \| MGC126383 \| SEMACL1 \| SEMAF \| SEMAI	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	in vitro in vivo	BioGRID	10318831
SH3BP4	BOG25 \| TTP	SH3-domain binding protein 4	Affinity Capture-MS	BioGRID	17353931
SLC2A1	DYT17 \| DYT18 \| GLUT \| GLUT1 \| MGC141895 \| MGC141896 \| PED	solute carrier family 2 (facilitated glucose transporter), member 1	-	HPRD,BioGRID	10198040
TAGLN	DKFZp686P11128 \| SM22 \| SMCC \| TAGLN1 \| WS3-10	transgelin	Affinity Capture-MS	BioGRID	17353931
TPBG	5T4 \| 5T4-AG \| M6P1	trophoblast glycoprotein	-	HPRD,BioGRID	11798178
TYRP1	CAS2 \| CATB \| GP75 \| TRP \| TYRP \| b-PROTEIN	tyrosinase-related protein 1	-	HPRD,BioGRID	11441007
ZFPM1	FOG \| FOG1 \| ZNF408 \| ZNF89A	zinc finger protein, multitype 1	-	HPRD,BioGRID	15231747

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID SYNDECAN 4 PATHWAY	32	25	All SZGR 2.0 genes in this pathway
PID TRKR PATHWAY	62	48	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION ERYTHROCYTE UP	157	104	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP UP	265	158	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 DN	153	100	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC DN	31	23	All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC 24HR 3 DN	13	8	All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN	382	224	All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN	261	155	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
LIN APC TARGETS	77	55	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
YAGI AML FAB MARKERS	191	131	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP	390	242	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
LU AGING BRAIN UP	262	186	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS REQUIRE MYC	210	123	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL DN	428	246	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	230	237	1A,m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-194	481	487	m8	hsa-miR-194	UGUAACAGCAACUCCAUGUGGA
miR-491	223	229	m8	hsa-miR-491^brain	AGUGGGGAACCCUUCCAUGAGGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GIPC1