SZGR2

Summary ?

GeneID	10971
Symbol	YWHAQ
Synonyms	14-3-3\|1C5\|HS1
Description	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta
Reference	MIM:609009\|HGNC:HGNC:12854\|Ensembl:ENSG00000134308\|HPRD:00886\|Vega:OTTHUMG00000013848
Gene type	protein-coding
Map location	2p25.1
Pascal p-value	0.248
Sherlock p-value	0.57
Fetal beta	0.741
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_mGluR5 G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.3547

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg02466933	2	9770529	YWHAQ	1.85E-5	-0.333	0.016	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs36781	chr5	109289728	YWHAQ	10971		0.12		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
KIF2C	0.97	0.69
TACC3	0.96	0.73
HJURP	0.96	0.70
PRC1	0.96	0.77
RAD51	0.96	0.68
BUB1B	0.96	0.79
GTSE1	0.96	0.73
NCAPH	0.96	0.73
NUSAP1	0.96	0.71
KIF20A	0.96	0.69

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.27	-0.40	-0.66
AF347015.33	-0.40	-0.67
AF347015.31	-0.40	-0.64
HLA-F	-0.40	-0.54
MT-CO2	-0.40	-0.65
MT-CYB	-0.39	-0.64
TINAGL1	-0.39	-0.56
C5orf53	-0.39	-0.48
PTH1R	-0.39	-0.51
AF347015.8	-0.38	-0.65

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0019904	protein domain specific binding	IEA		-
GO:0047485	protein N-terminus binding	IPI		11984006
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0045892	negative regulation of transcription, DNA-dependent	IDA		15163635
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005813	centrosome	IDA		18029348
GO:0005634	nucleus	IDA		18029348
GO:0005737	cytoplasm	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	Reconstituted Complex	BioGRID	11266503
ARHGEF2	DKFZp547L106 \| DKFZp547P1516 \| GEF \| GEF-H1 \| GEFH1 \| KIAA0651 \| LFP40 \| P40	rho/rac guanine nucleotide exchange factor (GEF) 2	Affinity Capture-Western	BioGRID	14970201
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	-	HPRD,BioGRID	9369453
BAX	BCL2L4	BCL2-associated X protein	-	HPRD,BioGRID	12426317
BRAF	B-RAF1 \| BRAF1 \| FLJ95109 \| MGC126806 \| MGC138284 \| RAFB1	v-raf murine sarcoma viral oncogene homolog B1	-	HPRD	8668348
BRAF	B-RAF1 \| BRAF1 \| FLJ95109 \| MGC126806 \| MGC138284 \| RAFB1	v-raf murine sarcoma viral oncogene homolog B1	Affinity Capture-MS	BioGRID	17353931
C22orf9	-	chromosome 22 open reading frame 9	Affinity Capture-MS	BioGRID	17353931
CABIN1	CAIN \| KIAA0330 \| PPP3IN	calcineurin binding protein 1	YWHAQ (14-3-3-theta) interacts with phosphorylated CABIN1. This interaction was modelled on a demonstrated interaction between mouse 14-3-3-theta and human CABIN1.	BIND	15902271
CALML5	CLSP	calmodulin-like 5	Affinity Capture-MS	BioGRID	17353931
CAPN3	CANP3 \| CANPL3 \| LGMD2 \| LGMD2A \| MGC10767 \| MGC11121 \| MGC14344 \| MGC4403 \| nCL-1 \| p94	calpain 3, (p94)	-	HPRD	15324660
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	-	HPRD,BioGRID	8663231 \|11024037
CBWD2	-	COBW domain containing 2	Affinity Capture-MS	BioGRID	17353931
CCAR1	CARP-1 \| CARP1 \| MGC44628 \| RP11-437A18.1	cell division cycle and apoptosis regulator 1	Affinity Capture-Western	BioGRID	12816952
CDC25B	-	cell division cycle 25 homolog B (S. pombe)	-	HPRD,BioGRID	10713667
CDC2L1	CDC2L2 \| CDK11 \| CDK11-p110 \| CDK11-p46 \| CDK11-p58 \| CLK-1 \| FLJ59152 \| PK58 \| p58 \| p58CDC2L1 \| p58CLK-1	cell division cycle 2-like 1 (PITSLRE proteins)	CDK11-p110 interacts with 14-3-3-theta.	BIND	15883043
CDKN1B	CDKN4 \| KIP1 \| MEN1B \| MEN4 \| P27KIP1	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	-	HPRD,BioGRID	12042314
CRTC2	RP11-422P24.6 \| TORC2	CREB regulated transcription coactivator 2	Affinity Capture-MS Affinity Capture-Western	BioGRID	15454081 \|17353931
DAPK1	DAPK \| DKFZp781I035	death-associated protein kinase 1	Affinity Capture-Western	BioGRID	12911633
DDX6	FLJ36338 \| HLR2 \| P54 \| RCK	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6	Affinity Capture-MS	BioGRID	17353931
DENND4A	FLJ33949 \| IRLB \| KIAA0476 \| MYCPBP	DENN/MADD domain containing 4A	Affinity Capture-MS	BioGRID	17353931
EDC3	FLJ21128 \| FLJ31777 \| LSM16 \| YJDC \| YJEFN2	enhancer of mRNA decapping 3 homolog (S. cerevisiae)	Affinity Capture-MS	BioGRID	17353931
EML3	ELP95 \| FLJ35827 \| MGC111422	echinoderm microtubule associated protein like 3	Affinity Capture-MS	BioGRID	17353931
EPB41L2	4.1-G \| DKFZp781D1972 \| DKFZp781H1755	erythrocyte membrane protein band 4.1-like 2	Affinity Capture-MS	BioGRID	17353931
EPB41L3	4.1B \| DAL-1 \| DAL1 \| FLJ37633 \| KIAA0987	erythrocyte membrane protein band 4.1-like 3	Affinity Capture-MS	BioGRID	17353931
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	Reconstituted Complex	BioGRID	11266503
ESR2	ER-BETA \| ESR-BETA \| ESRB \| ESTRB \| Erb \| NR3A2	estrogen receptor 2 (ER beta)	Reconstituted Complex	BioGRID	11266503
FAM83G	FLJ41564	family with sequence similarity 83, member G	Affinity Capture-MS	BioGRID	17353931
FGR	FLJ43153 \| MGC75096 \| SRC2 \| c-fgr \| c-src2 \| p55c-fgr \| p58c-fgr	Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog	-	HPRD	10066823
FSHR	FSHRO \| LGR1 \| MGC141667 \| MGC141668 \| ODG1	follicle stimulating hormone receptor	-	HPRD	15196694
FUSIP1	FUSIP2 \| NSSR \| SFRS13 \| SRp38 \| SRrp40 \| TASR \| TASR1 \| TASR2	FUS interacting protein (serine/arginine-rich) 1	Affinity Capture-MS	BioGRID	17353931
FXYD1	MGC44983 \| PLM	FXYD domain containing ion transport regulator 1	Reconstituted Complex	BioGRID	14597563
HDAC5	FLJ90614 \| HD5 \| NY-CO-9	histone deacetylase 5	Affinity Capture-Western Two-hybrid	BioGRID	15367659
HSPA8	HSC54 \| HSC70 \| HSC71 \| HSP71 \| HSP73 \| HSPA10 \| LAP1 \| MGC131511 \| MGC29929 \| NIP71	heat shock 70kDa protein 8	-	HPRD	15324660
IRS2	-	insulin receptor substrate 2	Affinity Capture-MS	BioGRID	17353931
KIAA1409	FLJ43337	KIAA1409	Affinity Capture-MS	BioGRID	17353931
KIF23	CHO1 \| KNSL5 \| MKLP-1 \| MKLP1	kinesin family member 23	Affinity Capture-MS	BioGRID	17353931
KIF5B	KINH \| KNS \| KNS1 \| UKHC	kinesin family member 5B	Affinity Capture-MS	BioGRID	17353931
KIF5C	FLJ44735 \| KIAA0531 \| KINN \| MGC111478 \| NKHC \| NKHC-2 \| NKHC2	kinesin family member 5C	Affinity Capture-MS	BioGRID	17353931
KLC2	FLJ12387	kinesin light chain 2	Affinity Capture-MS	BioGRID	17353931
KLC3	KLC2 \| KLC2L \| KLCt \| KNS2B	kinesin light chain 3	-	HPRD	15324660
KLC4	KNSL8 \| MGC111777 \| bA387M24.3	kinesin light chain 4	Affinity Capture-MS	BioGRID	17353931
KRT18	CYK18 \| K18	keratin 18	Affinity Capture-Western	BioGRID	9524113
LARP1	KIAA0731 \| LARP \| MGC19556	La ribonucleoprotein domain family, member 1	Affinity Capture-MS	BioGRID	17353931
LUC7L2	CGI-59 \| CGI-74 \| FLJ10657 \| LUC7B2	LUC7-like 2 (S. cerevisiae)	Affinity Capture-MS	BioGRID	17353931
LYST	CHS \| CHS1	lysosomal trafficking regulator	-	HPRD,BioGRID	11984006
MARK2	EMK1 \| MGC99619 \| PAR-1 \| Par1b	MAP/microtubule affinity-regulating kinase 2	Affinity Capture-MS	BioGRID	17353931
MARK3	CTAK1 \| KP78 \| PAR1A	MAP/microtubule affinity-regulating kinase 3	Affinity Capture-MS	BioGRID	17353931
MED1	CRSP1 \| CRSP200 \| DRIP205 \| DRIP230 \| MGC71488 \| PBP \| PPARBP \| PPARGBP \| RB18A \| TRAP220 \| TRIP2	mediator complex subunit 1	Reconstituted Complex	BioGRID	11266503
MEF2D	DKFZp686I1536	myocyte enhancer factor 2D	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	11433030
MLLT4	AF-6 \| AF6 \| AFADIN \| FLJ34371 \| RP3-431P23.3	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	Affinity Capture-MS	BioGRID	17353931
MPRIP	KIAA0864 \| M-RIP \| RHOIP3 \| p116Rip	myosin phosphatase Rho interacting protein	Affinity Capture-MS	BioGRID	17353931
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	Reconstituted Complex	BioGRID	11266503
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	Reconstituted Complex	BioGRID	11266503
NFATC2	KIAA0611 \| NFAT1 \| NFATP	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	-	HPRD,BioGRID	10611249
NFATC4	NF-ATc4 \| NFAT3	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	-	HPRD,BioGRID	10611249
NIF3L1	ALS2CR1 \| CALS-7 \| MDS015	NIF3 NGG1 interacting factor 3-like 1 (S. pombe)	-	HPRD,BioGRID	15163635
NRIP1	FLJ77253 \| RIP140	nuclear receptor interacting protein 1	Co-localization Phenotypic Suppression Reconstituted Complex	BioGRID	11266503
PAK4	-	p21 protein (Cdc42/Rac)-activated kinase 4	Affinity Capture-MS	BioGRID	17353931
PAK6	PAK5	p21 protein (Cdc42/Rac)-activated kinase 6	Affinity Capture-MS	BioGRID	17353931
PANK2	C20orf48 \| FLJ17232 \| HARP \| HSS \| MGC15053 \| NBIA1 \| PKAN	pantothenate kinase 2	Affinity Capture-MS	BioGRID	17353931
PDPK1	MGC20087 \| MGC35290 \| PDK1 \| PRO0461	3-phosphoinositide dependent protein kinase-1	-	HPRD,BioGRID	12177059
PFKFB2	DKFZp781D2217 \| MGC138308 \| MGC138310 \| PFK-2/FBPase-2	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2	-	HPRD,BioGRID	12853467
PI4KB	PI4K-BETA \| PI4KIIIbeta \| PI4Kbeta \| PIK4CB \| pi4K92	phosphatidylinositol 4-kinase, catalytic, beta	Affinity Capture-MS	BioGRID	17353931
PI4KB	PI4K-BETA \| PI4KIIIbeta \| PI4Kbeta \| PIK4CB \| pi4K92	phosphatidylinositol 4-kinase, catalytic, beta	-	HPRD	15324660
PIK3CA	MGC142161 \| MGC142163 \| PI3K \| p110-alpha	phosphoinositide-3-kinase, catalytic, alpha polypeptide	Reconstituted Complex	BioGRID	8663231
PIK3CG	PI3CG \| PI3K \| PI3Kgamma \| PIK3	phosphoinositide-3-kinase, catalytic, gamma polypeptide	Affinity Capture-Western	BioGRID	8663231
PNKP	PNK	polynucleotide kinase 3'-phosphatase	Affinity Capture-MS	BioGRID	17353931
PPFIBP1	L2 \| hSGT2 \| hSgt2p	PTPRF interacting protein, binding protein 1 (liprin beta 1)	Affinity Capture-MS	BioGRID	17353931
PRKCZ	PKC-ZETA \| PKC2	protein kinase C, zeta	Affinity Capture-Western Biochemical Activity Reconstituted Complex	BioGRID	10620507
PRKD1	PKC-MU \| PKCM \| PKD \| PRKCM	protein kinase D1	Affinity Capture-Western Reconstituted Complex	BioGRID	10092600 \|10831594
RABEP1	RAB5EP \| RABPT5	rabaptin, RAB GTPase binding effector protein 1	Affinity Capture-MS	BioGRID	17353931
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	Affinity Capture-MS Affinity Capture-Western Far Western Reconstituted Complex	BioGRID	8663231 \|10620507 \|10757792 \|17353931
RAI14	DKFZp564G013 \| KIAA1334 \| NORPEG \| RAI13	retinoic acid induced 14	Affinity Capture-MS	BioGRID	17353931
RASGRP3	GRP3 \| KIAA0846	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	Affinity Capture-MS	BioGRID	17353931
REM1	GD:REM \| GES \| MGC48669 \| REM	RAS (RAD and GEM)-like GTP-binding 1	-	HPRD,BioGRID	10441394
RPL21	DKFZp686C06101 \| FLJ27458 \| L21 \| MGC104274 \| MGC104275 \| MGC71252	ribosomal protein L21	Affinity Capture-MS	BioGRID	17353931
SAMD4B	FLJ10211 \| MGC99832 \| SMGB	sterile alpha motif domain containing 4B	Affinity Capture-MS	BioGRID	17353931
SFRS1	ASF \| MGC5228 \| SF2 \| SF2p33 \| SRp30a	splicing factor, arginine/serine-rich 1	Affinity Capture-MS	BioGRID	17353931
SFRS3	SRp20	splicing factor, arginine/serine-rich 3	Affinity Capture-MS	BioGRID	17353931
SFRS6	B52 \| FLJ08061 \| MGC5045 \| SRP55	splicing factor, arginine/serine-rich 6	Affinity Capture-MS	BioGRID	17353931
SH3BP4	BOG25 \| TTP	SH3-domain binding protein 4	Affinity Capture-MS	BioGRID	17353931
SPIRE1	MGC150621 \| MGC150622 \| Spir-1	spire homolog 1 (Drosophila)	Affinity Capture-MS	BioGRID	17353931
SUV420H1	CGI-85 \| CGI85 \| KMT5B \| MGC118906 \| MGC118909 \| MGC21161 \| MGC703	suppressor of variegation 4-20 homolog 1 (Drosophila)	Affinity Capture-MS	BioGRID	17353931
TERT	EST2 \| TCS1 \| TP2 \| TRT \| hEST2	telomerase reverse transcriptase	Reconstituted Complex Two-hybrid	BioGRID	10835362
THRA	AR7 \| EAR7 \| ERB-T-1 \| ERBA \| ERBA1 \| MGC000261 \| MGC43240 \| NR1A1 \| THRA1 \| THRA2 \| c-ERBA-1	thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)	Reconstituted Complex	BioGRID	11266503
TJP2	MGC26306 \| X104 \| ZO-2 \| ZO2	tight junction protein 2 (zona occludens 2)	Affinity Capture-MS	BioGRID	17353931
TSC1	KIAA0243 \| LAM \| MGC86987 \| TSC	tuberous sclerosis 1	Hamartin interacts with 14-3-3-tau. This interaction is modeled on demonstrated interaction between human hamartin and mouse 14-3-3-tau isoform.	BIND	12176984
TSC2	FLJ43106 \| LAM \| TSC4	tuberous sclerosis 2	Affinity Capture-MS	BioGRID	17353931
TSC2	FLJ43106 \| LAM \| TSC4	tuberous sclerosis 2	Tumor suppressor protein tuberin interacts with 14-3-3-tau isoform. This interaction is modeled on demonstrated interaction between human tuberin and mouse 14-3-3-tau isoform.	BIND	12176984
TSC2	FLJ43106 \| LAM \| TSC4	tuberous sclerosis 2	-	HPRD	12438239
TUBA3C	TUBA2 \| bA408E5.3	tubulin, alpha 3c	-	HPRD	15324660
UCP2	BMIQ4 \| SLC25A8 \| UCPH	uncoupling protein 2 (mitochondrial, proton carrier)	-	HPRD,BioGRID	10785390
UCP2	BMIQ4 \| SLC25A8 \| UCPH	uncoupling protein 2 (mitochondrial, proton carrier)	UCP2 interacts with 14.3.3-theta.	BIND	10785390
UCP3	SLC25A9	uncoupling protein 3 (mitochondrial, proton carrier)	UCP3 interacts with 14.3.3-theta.	BIND	10785390
UCP3	SLC25A9	uncoupling protein 3 (mitochondrial, proton carrier)	-	HPRD,BioGRID	10785390
USP8	FLJ34456 \| HumORF8 \| KIAA0055 \| MGC129718 \| UBPY	ubiquitin specific peptidase 8	Affinity Capture-MS	BioGRID	17353931
WDR77	HKMT1069 \| MEP50 \| MGC2722 \| Nbla10071 \| RP11-552M11.3 \| p44	WD repeat domain 77	-	HPRD	15324660
YAP1	YAP \| YAP2 \| YAP65 \| YKI	Yes-associated protein 1, 65kDa	-	HPRD,BioGRID	12535517

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CELL CYCLE	128	84	All SZGR 2.0 genes in this pathway
KEGG OOCYTE MEIOSIS	114	79	All SZGR 2.0 genes in this pathway
KEGG NEUROTROPHIN SIGNALING PATHWAY	126	103	All SZGR 2.0 genes in this pathway
KEGG PATHOGENIC ESCHERICHIA COLI INFECTION	59	36	All SZGR 2.0 genes in this pathway
BIOCARTA G2 PATHWAY	24	20	All SZGR 2.0 genes in this pathway
BIOCARTA CHREBP2 PATHWAY	42	35	All SZGR 2.0 genes in this pathway
SIG PIP3 SIGNALING IN CARDIAC MYOCTES	67	54	All SZGR 2.0 genes in this pathway
SIG INSULIN RECEPTOR PATHWAY IN CARDIAC MYOCYTES	51	41	All SZGR 2.0 genes in this pathway
ST PHOSPHOINOSITIDE 3 KINASE PATHWAY	37	29	All SZGR 2.0 genes in this pathway
PID LKB1 PATHWAY	47	37	All SZGR 2.0 genes in this pathway
PID NFAT 3PATHWAY	54	47	All SZGR 2.0 genes in this pathway
PID MTOR 4PATHWAY	69	55	All SZGR 2.0 genes in this pathway
PID FOXO PATHWAY	49	43	All SZGR 2.0 genes in this pathway
PID ERBB1 DOWNSTREAM PATHWAY	105	78	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID P38 MK2 PATHWAY	21	19	All SZGR 2.0 genes in this pathway
PID BETA CATENIN NUC PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID A6B1 A6B4 INTEGRIN PATHWAY	46	35	All SZGR 2.0 genes in this pathway
PID INSULIN GLUCOSE PATHWAY	26	24	All SZGR 2.0 genes in this pathway
PID PI3KCI AKT PATHWAY	35	30	All SZGR 2.0 genes in this pathway
PID TAP63 PATHWAY	54	40	All SZGR 2.0 genes in this pathway
PID PI3K PLC TRK PATHWAY	36	31	All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA UP	305	185	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR UP	557	331	All SZGR 2.0 genes in this pathway
MAYBURD RESPONSE TO L663536 DN	56	32	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 48HR UP	128	95	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 96HR UP	117	84	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 UP	329	196	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN	770	415	All SZGR 2.0 genes in this pathway
WANG ESOPHAGUS CANCER VS NORMAL DN	101	66	All SZGR 2.0 genes in this pathway
MARTIN INTERACT WITH HDAC	44	31	All SZGR 2.0 genes in this pathway
LI AMPLIFIED IN LUNG CANCER	178	108	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
KOMMAGANI TP63 GAMMA TARGETS	9	7	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
SCIAN INVERSED TARGETS OF TP53 AND TP73 DN	31	23	All SZGR 2.0 genes in this pathway
DEN INTERACT WITH LCA5	26	21	All SZGR 2.0 genes in this pathway
SANA RESPONSE TO IFNG DN	85	56	All SZGR 2.0 genes in this pathway
FAELT B CLL WITH VH REARRANGEMENTS DN	48	26	All SZGR 2.0 genes in this pathway
MARCHINI TRABECTEDIN RESISTANCE UP	21	16	All SZGR 2.0 genes in this pathway
NATSUME RESPONSE TO INTERFERON BETA DN	52	33	All SZGR 2.0 genes in this pathway
ZAMORA NOS2 TARGETS DN	96	71	All SZGR 2.0 genes in this pathway
ZHONG SECRETOME OF LUNG CANCER AND FIBROBLAST	132	93	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER T4	94	69	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
ALONSO METASTASIS UP	198	128	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER SURVIVAL DN	175	103	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO CSF2RB AND IL4 UP	338	225	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF UP	418	282	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN	245	150	All SZGR 2.0 genes in this pathway
HSIAO HOUSEKEEPING GENES	389	245	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP	442	263	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP	756	494	All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP	682	440	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	400	406	m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-129-5p	944	950	1A	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	944	950	1A	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-139	934	940	m8	hsa-miR-139^brain	UCUACAGUGCACGUGUCU
miR-139	934	940	m8	hsa-miR-139^brain	UCUACAGUGCACGUGUCU
miR-15/16/195/424/497	617	623	m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-17-5p/20/93.mr/106/519.d	693	699	1A	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-203.1	225	231	1A	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-320	138	144	m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-376c	972	978	1A	hsa-miR-376c	AACAUAGAGGAAAUUCCACG
miR-378*	811	818	1A,m8	hsa-miR-422b	CUGGACUUGGAGUCAGAAGGCC
miR-378*	811	818	1A,m8	hsa-miR-422a	CUGGACUUAGGGUCAGAAGGCC
miR-543	961	967	1A	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: YWHAQ