Gene Page: DAB2
Summary ?
GeneID | 1601 |
Symbol | DAB2 |
Synonyms | DOC-2|DOC2 |
Description | Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila) |
Reference | MIM:601236|HGNC:HGNC:2662|Ensembl:ENSG00000153071|HPRD:03139|Vega:OTTHUMG00000162043 |
Gene type | protein-coding |
Map location | 5p13.1 |
Pascal p-value | 0.007 |
Sherlock p-value | 0.047 |
Fetal beta | -0.358 |
DMG | 2 (# studies) |
eGene | Myers' cis & trans Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 2 |
DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 2 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.056 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg15873715 | 5 | 39425138 | DAB2 | -0.028 | 0.26 | DMG:Nishioka_2013 | |
cg17491456 | 5 | 39424524 | DAB2 | 0.012 | -3.055 | DMG:vanEijk_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1421094 | chr5 | 39355590 | DAB2 | 1601 | 0.02 | cis | ||
rs1362800 | chr5 | 39378114 | DAB2 | 1601 | 0.06 | cis | ||
rs700242 | chr5 | 39384887 | DAB2 | 1601 | 0.02 | cis | ||
rs9506602 | chr13 | 21638359 | DAB2 | 1601 | 0.05 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ANAPC2 | 0.91 | 0.90 |
EGLN2 | 0.91 | 0.92 |
EPN1 | 0.91 | 0.90 |
HGS | 0.91 | 0.91 |
AP2A2 | 0.90 | 0.89 |
SAPS2 | 0.90 | 0.90 |
ARMC5 | 0.90 | 0.90 |
LONP1 | 0.89 | 0.89 |
LRSAM1 | 0.89 | 0.89 |
ZNF653 | 0.89 | 0.90 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.76 | -0.74 |
AF347015.31 | -0.75 | -0.69 |
MT-CO2 | -0.73 | -0.68 |
AF347015.27 | -0.72 | -0.69 |
AF347015.8 | -0.72 | -0.68 |
AF347015.33 | -0.72 | -0.66 |
MT-CYB | -0.71 | -0.66 |
AF347015.15 | -0.68 | -0.65 |
AF347015.2 | -0.68 | -0.64 |
AC021016.1 | -0.66 | -0.67 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008022 | protein C-terminus binding | IPI | 15837803 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000904 | cell morphogenesis involved in differentiation | IEA | - | |
GO:0001701 | in utero embryonic development | IEA | - | |
GO:0008283 | cell proliferation | TAS | 9620555 | |
GO:0007588 | excretion | IEA | - | |
GO:0006907 | pinocytosis | IEA | - | |
GO:0006898 | receptor-mediated endocytosis | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0005905 | coated pit | IDA | 12857860 | |
GO:0031410 | cytoplasmic vesicle | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AP2A2 | ADTAB | CLAPA2 | HIP9 | HYPJ | adaptor-related protein complex 2, alpha 2 subunit | Affinity Capture-Western | BioGRID | 11247302 |
AP2M1 | AP50 | CLAPM1 | mu2 | adaptor-related protein complex 2, mu 1 subunit | - | HPRD | 11247302 |
APLP1 | APLP | amyloid beta (A4) precursor-like protein 1 | Reconstituted Complex | BioGRID | 11247302 |
APLP2 | APPH | APPL2 | CDEBP | amyloid beta (A4) precursor-like protein 2 | Reconstituted Complex | BioGRID | 11247302 |
APP | AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 | amyloid beta (A4) precursor protein | Reconstituted Complex | BioGRID | 11247302 |
AXIN1 | AXIN | MGC52315 | axin 1 | Reconstituted Complex | BioGRID | 12805222 |
CDC2 | CDC28A | CDK1 | DKFZp686L20222 | MGC111195 | cell division cycle 2, G1 to S and G2 to M | - | HPRD,BioGRID | 12881709 |
CSK | MGC117393 | c-src tyrosine kinase | - | HPRD,BioGRID | 12473651 |
DAB2IP | AF9Q34 | AIP1 | DIP1/2 | FLJ39072 | KIAA1743 | DAB2 interacting protein | Affinity Capture-Western Reconstituted Complex | BioGRID | 11812785 |
DIP2A | C21orf106 | DIP2 | DIP2 disco-interacting protein 2 homolog A (Drosophila) | - | HPRD | 11812785 |
DVL1 | DVL | MGC54245 | dishevelled, dsh homolog 1 (Drosophila) | Reconstituted Complex | BioGRID | 12805222 |
DVL2 | - | dishevelled, dsh homolog 2 (Drosophila) | Affinity Capture-Western Reconstituted Complex | BioGRID | 12805222 |
DVL3 | KIAA0208 | dishevelled, dsh homolog 3 (Drosophila) | - | HPRD,BioGRID | 12805222 |
FGR | FLJ43153 | MGC75096 | SRC2 | c-fgr | c-src2 | p55c-fgr | p58c-fgr | Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog | - | HPRD,BioGRID | 12473651 |
INPP5D | MGC104855 | MGC142140 | MGC142142 | SHIP | SHIP1 | SIP-145 | hp51CN | inositol polyphosphate-5-phosphatase, 145kDa | Reconstituted Complex | BioGRID | 11247302 |
LDLR | FH | FHC | low density lipoprotein receptor | Reconstituted Complex | BioGRID | 11247302 |
LRP1 | A2MR | APOER | APR | CD91 | FLJ16451 | IGFBP3R | LRP | MGC88725 | TGFBR5 | low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) | Reconstituted Complex | BioGRID | 11247302 |
LRP2 | DBS | gp330 | low density lipoprotein-related protein 2 | - | HPRD,BioGRID | 10769163 |
MIB1 | DIP-1 | DKFZp686I0769 | DKFZp761M1710 | FLJ90676 | MGC129659 | MGC129660 | MIB | ZZANK2 | ZZZ6 | mindbomb homolog 1 (Drosophila) | - | HPRD | 11812785 |
MYO6 | DFNA22 | DFNB37 | KIAA0389 | myosin VI | - | HPRD,BioGRID | 11906161 |11967127 |
PIN1 | DOD | UBL5 | peptidylprolyl cis/trans isomerase, NIMA-interacting 1 | - | HPRD,BioGRID | 12881709 |
SMAD2 | JV18 | JV18-1 | MADH2 | MADR2 | MGC22139 | MGC34440 | hMAD-2 | hSMAD2 | SMAD family member 2 | - | HPRD,BioGRID | 11387212 |
SMAD3 | DKFZp586N0721 | DKFZp686J10186 | HSPC193 | HsT17436 | JV15-2 | MADH3 | MGC60396 | SMAD family member 3 | - | HPRD,BioGRID | 11387212 |
SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | - | HPRD,BioGRID | 12473651 |
TGFBR1 | AAT5 | ACVRLK4 | ALK-5 | ALK5 | LDS1A | LDS2A | SKR4 | TGFR-1 | transforming growth factor, beta receptor 1 | - | HPRD,BioGRID | 11387212 |
TGFBR2 | AAT3 | FAA3 | LDS1B | LDS2B | MFS2 | RIIC | TAAD2 | TGFR-2 | TGFbeta-RII | transforming growth factor, beta receptor II (70/80kDa) | - | HPRD,BioGRID | 11387212 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ENDOCYTOSIS | 183 | 132 | All SZGR 2.0 genes in this pathway |
PID TGFBR PATHWAY | 55 | 38 | All SZGR 2.0 genes in this pathway |
REACTOME GAP JUNCTION DEGRADATION | 10 | 8 | All SZGR 2.0 genes in this pathway |
REACTOME MEMBRANE TRAFFICKING | 129 | 74 | All SZGR 2.0 genes in this pathway |
REACTOME GAP JUNCTION TRAFFICKING | 27 | 19 | All SZGR 2.0 genes in this pathway |
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA UP | 205 | 140 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP | 351 | 230 | All SZGR 2.0 genes in this pathway |
FRASOR TAMOXIFEN RESPONSE UP | 51 | 36 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER ADVANCED VS EARLY UP | 175 | 120 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP | 233 | 161 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN | 205 | 127 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D DN | 142 | 90 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 DN | 281 | 186 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP | 185 | 126 | All SZGR 2.0 genes in this pathway |
PAPASPYRIDONOS UNSTABLE ATEROSCLEROTIC PLAQUE UP | 52 | 36 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS DN | 260 | 143 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 2HR DN | 88 | 53 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA DN | 284 | 156 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 8HR UP | 164 | 122 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR UP | 162 | 116 | All SZGR 2.0 genes in this pathway |
BIDUS METASTASIS DN | 161 | 93 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER LMP DN | 199 | 124 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 DN | 67 | 43 | All SZGR 2.0 genes in this pathway |
HAHTOLA MYCOSIS FUNGOIDES SKIN UP | 177 | 113 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS UP | 194 | 112 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 DN | 153 | 100 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2A DN | 141 | 84 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 3 UP | 329 | 196 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS F UP | 185 | 119 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
YANAGIHARA ESX1 TARGETS | 30 | 19 | All SZGR 2.0 genes in this pathway |
MAINA VHL TARGETS UP | 10 | 6 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 2 DN | 51 | 42 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
JECHLINGER EPITHELIAL TO MESENCHYMAL TRANSITION UP | 71 | 51 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
SANA RESPONSE TO IFNG DN | 85 | 56 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
BROWN MYELOID CELL DEVELOPMENT UP | 165 | 100 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
NEMETH INFLAMMATORY RESPONSE LPS UP | 88 | 64 | All SZGR 2.0 genes in this pathway |
HESS TARGETS OF HOXA9 AND MEIS1 DN | 77 | 48 | All SZGR 2.0 genes in this pathway |
RORIE TARGETS OF EWSR1 FLI1 FUSION UP | 30 | 22 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
IGLESIAS E2F TARGETS UP | 151 | 103 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
TSENG IRS1 TARGETS DN | 135 | 88 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS PEAK AT 0HR | 63 | 48 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 12HR DN | 101 | 64 | All SZGR 2.0 genes in this pathway |
BILD MYC ONCOGENIC SIGNATURE | 206 | 117 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION | 88 | 65 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
HOQUE METHYLATED IN CANCER | 56 | 45 | All SZGR 2.0 genes in this pathway |
IZADPANAH STEM CELL ADIPOSE VS BONE DN | 108 | 68 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
LINDSTEDT DENDRITIC CELL MATURATION D | 68 | 44 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 DN | 315 | 201 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
CHANG CORE SERUM RESPONSE DN | 209 | 137 | All SZGR 2.0 genes in this pathway |
ROSS LEUKEMIA WITH MLL FUSIONS | 78 | 49 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 11 | 36 | 24 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G5 DN | 27 | 17 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SURVIVAL UP | 73 | 49 | All SZGR 2.0 genes in this pathway |
WOO LIVER CANCER RECURRENCE UP | 105 | 75 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
KYNG WERNER SYNDROM AND NORMAL AGING UP | 93 | 62 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 16 | 79 | 47 | All SZGR 2.0 genes in this pathway |
NAKAMURA ADIPOGENESIS EARLY DN | 38 | 27 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO GONADOTROPHINS DN | 87 | 66 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO FORSKOLIN DN | 88 | 68 | All SZGR 2.0 genes in this pathway |
KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA MESENCHYMAL | 216 | 130 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS UP | 217 | 131 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS GROUP1 | 136 | 76 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
WANG MLL TARGETS | 289 | 188 | All SZGR 2.0 genes in this pathway |
ALFANO MYC TARGETS | 239 | 156 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY LUMINAL MATURE DN | 99 | 74 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-149 | 73 | 79 | 1A | hsa-miR-149brain | UCUGGCUCCGUGUCUUCACUCC |
miR-320 | 105 | 111 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-330 | 107 | 113 | 1A | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.