Gene Page: DPYSL2
Summary ?
GeneID | 1808 |
Symbol | DPYSL2 |
Synonyms | CRMP-2|CRMP2|DHPRP2|DRP-2|DRP2|N2A3|ULIP-2|ULIP2 |
Description | dihydropyrimidinase like 2 |
Reference | MIM:602463|HGNC:HGNC:3014|Ensembl:ENSG00000092964|HPRD:03914|Vega:OTTHUMG00000099439 |
Gene type | protein-coding |
Map location | 8p22-p21 |
Pascal p-value | 0.02 |
Sherlock p-value | 0.269 |
Fetal beta | 0.899 |
Support | STRUCTURAL PLASTICITY G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_mitochondria G2Cdb.human_Synaptosome G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 4 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ZC3H18 | 0.83 | 0.85 |
PHRF1 | 0.83 | 0.84 |
AXIN1 | 0.82 | 0.84 |
ELAVL3 | 0.82 | 0.82 |
SART1 | 0.82 | 0.83 |
AZI1 | 0.81 | 0.83 |
AD000671.1 | 0.81 | 0.85 |
MLLT1 | 0.81 | 0.82 |
ZC3H4 | 0.81 | 0.85 |
ZNF646 | 0.81 | 0.85 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C5orf53 | -0.63 | -0.69 |
AF347015.31 | -0.61 | -0.73 |
B2M | -0.61 | -0.70 |
MT-CO2 | -0.58 | -0.70 |
IFI27 | -0.57 | -0.67 |
AF347015.27 | -0.57 | -0.69 |
HIGD1B | -0.57 | -0.70 |
S100B | -0.56 | -0.64 |
COPZ2 | -0.56 | -0.64 |
MYL3 | -0.56 | -0.69 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004157 | dihydropyrimidinase activity | TAS | 8973361 | |
GO:0005515 | protein binding | IPI | 16260607 | |
GO:0016810 | hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 8973361 |
GO:0006139 | nucleobase, nucleoside, nucleotide and nucleic acid metabolic process | TAS | 8973361 | |
GO:0007165 | signal transduction | TAS | 8973361 | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0043025 | cell soma | IEA | axon, dendrite (GO term level: 4) | - |
GO:0030425 | dendrite | IEA | neuron, axon, dendrite (GO term level: 6) | - |
GO:0030424 | axon | IEA | neuron, axon, Neurotransmitter (GO term level: 6) | - |
GO:0005856 | cytoskeleton | IDA | 18029348 | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005739 | mitochondrion | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME CRMPS IN SEMA3A SIGNALING | 14 | 14 | All SZGR 2.0 genes in this pathway |
REACTOME SEMAPHORIN INTERACTIONS | 68 | 53 | All SZGR 2.0 genes in this pathway |
REACTOME L1CAM INTERACTIONS | 86 | 62 | All SZGR 2.0 genes in this pathway |
REACTOME RECYCLING PATHWAY OF L1 | 27 | 15 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
LIU VMYB TARGETS UP | 127 | 78 | All SZGR 2.0 genes in this pathway |
LAIHO COLORECTAL CANCER SERRATED UP | 112 | 71 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA UP | 171 | 112 | All SZGR 2.0 genes in this pathway |
ELVIDGE HIF1A AND HIF2A TARGETS DN | 104 | 72 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2A DN | 141 | 84 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
MATTIOLI MULTIPLE MYELOMA WITH 14Q32 TRANSLOCATIONS | 36 | 25 | All SZGR 2.0 genes in this pathway |
HERNANDEZ MITOTIC ARREST BY DOCETAXEL 1 DN | 38 | 23 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN 2FC UP | 14 | 7 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BENPORATH NOS TARGETS | 179 | 105 | All SZGR 2.0 genes in this pathway |
KENNY CTNNB1 TARGETS DN | 52 | 34 | All SZGR 2.0 genes in this pathway |
PENG GLUCOSE DEPRIVATION DN | 169 | 112 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
ZHANG TARGETS OF EWSR1 FLI1 FUSION | 88 | 68 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA MF UP | 47 | 27 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED DN | 246 | 180 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA DN | 41 | 27 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
DELASERNA MYOD TARGETS DN | 57 | 42 | All SZGR 2.0 genes in this pathway |
LEE AGING CEREBELLUM DN | 86 | 66 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
TOOKER GEMCITABINE RESISTANCE DN | 122 | 84 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF DN | 235 | 144 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN | 245 | 150 | All SZGR 2.0 genes in this pathway |
CHANG CORE SERUM RESPONSE DN | 209 | 137 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 11 | 36 | 24 | All SZGR 2.0 genes in this pathway |
WOO LIVER CANCER RECURRENCE UP | 105 | 75 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
WINNEPENNINCKX MELANOMA METASTASIS DN | 46 | 26 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE DN | 103 | 67 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP | 259 | 159 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
IKEDA MIR30 TARGETS UP | 116 | 87 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY LUMINAL MATURE DN | 99 | 74 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-130/301 | 1865 | 1871 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-145 | 534 | 540 | m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-17-5p/20/93.mr/106/519.d | 1867 | 1873 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-181 | 2148 | 2154 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-224 | 2207 | 2213 | m8 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
miR-29 | 997 | 1004 | 1A,m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-30-5p | 2112 | 2118 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG | ||||
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-329 | 2318 | 2324 | 1A | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
miR-409-5p | 2348 | 2354 | 1A | hsa-miR-409-5p | AGGUUACCCGAGCAACUUUGCA |
miR-410 | 2423 | 2429 | m8 | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-494 | 2463 | 2469 | 1A | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.