SZGR2

Summary ?

GeneID	2066
Symbol	ERBB4
Synonyms	ALS19\|HER4\|p180erbB4
Description	erb-b2 receptor tyrosine kinase 4
Reference	MIM:600543\|HGNC:HGNC:3432\|Ensembl:ENSG00000178568\|HPRD:02767\|Vega:OTTHUMG00000133012
Gene type	protein-coding
Map location	2q33.3-q34
Fetal beta	-0.176
DMG	1 (# studies)
Support	Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	2	Link to SZGene
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.01016
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00916
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizotypy,schizophrenias,schizotypal	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 33.331

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg04784316	2	212609384	ERBB4	1.001E-4	-0.84	0.028	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
EIF2C1	0.88	0.87
ANKFY1	0.88	0.90
ZFYVE26	0.88	0.89
SEC16A	0.88	0.88
TRRAP	0.87	0.87
EP400	0.87	0.88
ABL1	0.87	0.85
RNF144A	0.86	0.85
KIAA0355	0.86	0.88
DIP2A	0.86	0.88

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.59	-0.70
MT-CO2	-0.57	-0.70
C5orf53	-0.57	-0.62
HIGD1B	-0.57	-0.70
IFI27	-0.57	-0.67
FXYD1	-0.56	-0.66
C1orf54	-0.54	-0.75
AF347015.21	-0.54	-0.74
AF347015.27	-0.54	-0.65
MYL3	-0.54	-0.67

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004714	transmembrane receptor protein tyrosine kinase activity	TAS	neurite (GO term level: 8)	8383326
GO:0000166	nucleotide binding	IEA		-
GO:0004872	receptor activity	IEA		-
GO:0005515	protein binding	IPI		9419975 \|10572067 \|11867753
GO:0005524	ATP binding	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0046982	protein heterodimerization activity	IDA		10572067
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	IEA		-
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0007165	signal transduction	IDA		10572067
GO:0008283	cell proliferation	TAS		8383326
GO:0007275	multicellular organismal development	TAS		8383326
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	IEA		-
GO:0005887	integral to plasma membrane	TAS		8383326
GO:0016323	basolateral plasma membrane	IDA		12646923

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BTC	-	betacellulin	-	HPRD	11254912
CD44	CDW44 \| CSPG8 \| ECMR-III \| HCELL \| IN \| LHR \| MC56 \| MDU2 \| MDU3 \| MGC10468 \| MIC4 \| MUTCH-I \| Pgp1	CD44 molecule (Indian blood group)	-	HPRD,BioGRID	11825873
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	Affinity Capture-MS	BioGRID	16729043
CTGF	CCN2 \| HCS24 \| IGFBP8 \| MGC102839 \| NOV2	connective tissue growth factor	-	HPRD	12297288
DLG1	DKFZp761P0818 \| DKFZp781B0426 \| DLGH1 \| SAP97 \| dJ1061C18.1.1 \| hdlg	discs, large homolog 1 (Drosophila)	-	HPRD,BioGRID	12175853
DLG2	DKFZp781D1854 \| DKFZp781E0954 \| FLJ37266 \| MGC131811 \| PSD-93	discs, large homolog 2, chapsyn-110 (Drosophila)	-	HPRD,BioGRID	10725395
DLG2	DKFZp781D1854 \| DKFZp781E0954 \| FLJ37266 \| MGC131811 \| PSD-93	discs, large homolog 2, chapsyn-110 (Drosophila)	ErbB-4 interacts with CHAPSYN-110.	BIND	10725395
DLG3	KIAA1232 \| MRX \| MRX90 \| NE-Dlg \| NEDLG \| SAP102	discs, large homolog 3 (neuroendocrine-dlg, Drosophila)	-	HPRD,BioGRID	10725395 \|12175853
DLG3	KIAA1232 \| MRX \| MRX90 \| NE-Dlg \| NEDLG \| SAP102	discs, large homolog 3 (neuroendocrine-dlg, Drosophila)	ErbB-4 interacts with SAP-102.	BIND	10725395
DLG4	FLJ97752 \| FLJ98574 \| PSD95 \| SAP90	discs, large homolog 4 (Drosophila)	-	HPRD,BioGRID	10725395
DLG4	FLJ97752 \| FLJ98574 \| PSD95 \| SAP90	discs, large homolog 4 (Drosophila)	ErbB-4 interacts with PSD-95.	BIND	10725395
ERBB2	CD340 \| HER-2 \| HER-2/neu \| HER2 \| NEU \| NGL \| TKR1	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)	Affinity Capture-Western	BioGRID	10839362
EREG	ER	epiregulin	-	HPRD,BioGRID	9419975
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	Affinity Capture-MS	BioGRID	16729043
HBEGF	DTR \| DTS \| DTSF \| HEGFL	heparin-binding EGF-like growth factor	-	HPRD	9135143
MUC1	CD227 \| EMA \| H23AG \| MAM6 \| PEM \| PEMT \| PUM	mucin 1, cell surface associated	-	HPRD,BioGRID	11278868
NCK1	MGC12668 \| NCK \| NCKalpha	NCK adaptor protein 1	Affinity Capture-MS	BioGRID	16729043
NRG1	ARIA \| GGF \| GGF2 \| HGL \| HRG \| HRG1 \| HRGA \| NDF \| SMDF	neuregulin 1	Reconstituted Complex	BioGRID	9168115
NRG1	ARIA \| GGF \| GGF2 \| HGL \| HRG \| HRG1 \| HRGA \| NDF \| SMDF	neuregulin 1	-	HPRD	7721889 \|8062828 \|10537356
NRG2	Don-1 \| HRG2 \| NTAK	neuregulin 2	-	HPRD,BioGRID	9168114 \|9168115
NRG3	HRG3 \| pro-NRG3	neuregulin 3	-	HPRD	9275162
NRG4	DKFZp779N0541 \| DKFZp779N1944 \| HRG4	neuregulin 4	-	HPRD	10348342
PIK3R2	P85B \| p85 \| p85-BETA	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	Affinity Capture-MS	BioGRID	16729043
PTPN11	BPTP3 \| CFC \| MGC14433 \| NS1 \| PTP-1D \| PTP2C \| SH-PTP2 \| SH-PTP3 \| SHP2	protein tyrosine phosphatase, non-receptor type 11	Affinity Capture-MS	BioGRID	16729043
RNF41	MGC45228 \| NRDP1 \| SBBI03	ring finger protein 41	-	HPRD,BioGRID	11867753
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	Affinity Capture-MS	BioGRID	16729043
SNTB2	D16S2531E \| EST25263 \| SNT2B2 \| SNT3 \| SNTL	syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)	-	HPRD,BioGRID	10725395
SNTB2	D16S2531E \| EST25263 \| SNT2B2 \| SNT3 \| SNTL	syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)	ErbB-4 interacts with beta 2-syntropin.	BIND	10725395
STAT5A	MGF \| STAT5	signal transducer and activator of transcription 5A	Affinity Capture-MS Affinity Capture-Western	BioGRID	15534001 \|16729043
YAP1	YAP \| YAP2 \| YAP65 \| YKI	Yes-associated protein 1, 65kDa	-	HPRD,BioGRID	15023535

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ERBB SIGNALING PATHWAY	87	71	All SZGR 2.0 genes in this pathway
KEGG CALCIUM SIGNALING PATHWAY	178	134	All SZGR 2.0 genes in this pathway
KEGG ENDOCYTOSIS	183	132	All SZGR 2.0 genes in this pathway
BIOCARTA HER2 PATHWAY	22	17	All SZGR 2.0 genes in this pathway
SIG PIP3 SIGNALING IN CARDIAC MYOCTES	67	54	All SZGR 2.0 genes in this pathway
PID ERBB4 PATHWAY	38	32	All SZGR 2.0 genes in this pathway
PID ERBB NETWORK PATHWAY	15	13	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB4	90	67	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB2	101	78	All SZGR 2.0 genes in this pathway
REACTOME GRB2 EVENTS IN ERBB2 SIGNALING	22	20	All SZGR 2.0 genes in this pathway
REACTOME PI3K EVENTS IN ERBB4 SIGNALING	38	28	All SZGR 2.0 genes in this pathway
REACTOME SHC1 EVENTS IN ERBB4 SIGNALING	20	17	All SZGR 2.0 genes in this pathway
REACTOME PI3K EVENTS IN ERBB2 SIGNALING	44	34	All SZGR 2.0 genes in this pathway
REACTOME NUCLEAR SIGNALING BY ERBB4	38	30	All SZGR 2.0 genes in this pathway
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN	169	118	All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE DN	84	53	All SZGR 2.0 genes in this pathway
HUTTMANN B CLL POOR SURVIVAL UP	276	187	All SZGR 2.0 genes in this pathway
DOANE BREAST CANCER ESR1 UP	112	72	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
ODONNELL METASTASIS UP	82	58	All SZGR 2.0 genes in this pathway
BREUHAHN GROWTH FACTOR SIGNALING IN LIVER CANCER	22	19	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL	330	217	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
KORKOLA YOLK SAC TUMOR	62	33	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS DN	193	112	All SZGR 2.0 genes in this pathway
YANG BREAST CANCER ESR1 UP	36	22	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
DING LUNG CANCER MUTATED SIGNIFICANTLY	26	22	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN	546	351	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 UP	182	119	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY HNE AND TBH	60	42	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5	482	296	All SZGR 2.0 genes in this pathway
KONDO PROSTATE CANCER HCP WITH H3K27ME3	97	72	All SZGR 2.0 genes in this pathway
FINETTI BREAST CANCERS KINOME BLUE	21	16	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP	578	341	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BRAIN DN	85	58	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B UP	172	109	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 UP	167	99	All SZGR 2.0 genes in this pathway
POOLA INVASIVE BREAST CANCER DN	134	83	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR DN	91	56	All SZGR 2.0 genes in this pathway
LIU TOPBP1 TARGETS	16	8	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	7184	7190	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-125/351	6482	6488	m8	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	6482	6488	m8	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-130/301	1080	1086	m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-135	5566	5573	1A,m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
				hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
				hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
				hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-137	1140	1147	1A,m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-138	1156	1162	1A	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-143	6806	6812	m8	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-144	7184	7190	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-146	7692	7699	1A,m8	hsa-miR-146a	UGAGAACUGAAUUCCAUGGGUU
miR-146	7692	7699	1A,m8	hsa-miR-146b^brain	UGAGAACUGAAUUCCAUAGGCU
miR-19	1079	1085	m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	1079	1085	m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-193	91	98	1A,m8	hsa-miR-193a	AACUGGCCUACAAAGUCCCAG
miR-193	91	98	1A,m8	hsa-miR-193b	AACUGGCCCUCAAAGUCCCGCUUU
miR-194	7825	7831	1A	hsa-miR-194	UGUAACAGCAACUCCAUGUGGA
miR-199	1034	1041	1A,m8	hsa-miR-199a	CCCAGUGUUCAGACUACCUGUUC
miR-199	1034	1041	1A,m8	hsa-miR-199b	CCCAGUGUUUAGACUAUCUGUUC
miR-205	7506	7513	1A,m8	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-221/222	6627	6634	1A,m8	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	6627	6634	1A,m8	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC
miR-23	7199	7206	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	7199	7206	1A,m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-24*	6253	6260	1A,m8	hsa-miR-189	GUGCCUACUGAGCUGAUAUCAGU
miR-26	157	163	1A	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	157	163	1A	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-30-3p	178	184	m8	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	178	184	m8	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-323	7199	7205	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-326	5021	5028	1A,m8	hsa-miR-326	CCUCUGGGCCCUUCCUCCAG
miR-330	7266	7273	1A,m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-330	7266	7273	1A,m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-362	7698	7704	m8	hsa-miR-362	AAUCCUUGGAACCUAGGUGUGAGU
miR-381	7325	7331	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-383	7782	7788	1A	hsa-miR-383^brain	AGAUCAGAAGGUGAUUGUGGCU
miR-495	7823	7829	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-543	7543	7549	1A	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-543	7543	7549	1A	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-7	73	79	m8	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG
miR-93.hd/291-3p/294/295/302/372/373/520	1082	1088	1A	hsa-miR-93^brain	AAAGUGCUGUUCGUGCAGGUAG
				hsa-miR-302a	UAAGUGCUUCCAUGUUUUGGUGA
				hsa-miR-302b	UAAGUGCUUCCAUGUUUUAGUAG
				hsa-miR-302c	UAAGUGCUUCCAUGUUUCAGUGG
				hsa-miR-302d	UAAGUGCUUCCAUGUUUGAGUGU
				hsa-miR-372	AAAGUGCUGCGACAUUUGAGCGU
				hsa-miR-373	GAAGUGCUUCGAUUUUGGGGUGU
				hsa-miR-520e	AAAGUGCUUCCUUUUUGAGGG
				hsa-miR-520a	AAAGUGCUUCCCUUUGGACUGU
				hsa-miR-520b	AAAGUGCUUCCUUUUAGAGGG
				hsa-miR-520c	AAAGUGCUUCCUUUUAGAGGGUU
				hsa-miR-520d	AAAGUGCUUCUCUUUGGUGGGUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ERBB4