SZGR2

Summary ?

GeneID	2130
Symbol	EWSR1
Synonyms	EWS\|EWS-FLI1\|bK984G1.4
Description	EWS RNA binding protein 1
Reference	MIM:133450\|HGNC:HGNC:3508\|Ensembl:ENSG00000182944\|HPRD:00592\|Vega:OTTHUMG00000151107
Gene type	protein-coding
Map location	22q12.2
Pascal p-value	0.387
Sherlock p-value	0.005
Fetal beta	0.96
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_I	Genome scan meta-analysis	Psr: 0.031
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.017

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs1205088	chr14	72282058	EWSR1	2130		0.13		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CUL9	0.87	0.88
ZCCHC2	0.86	0.89
IPPK	0.86	0.86
EIF4G3	0.86	0.86
VPS53	0.86	0.86
STAT2	0.85	0.86
PDCD6IP	0.85	0.85
UBE3B	0.85	0.85
ZNF331	0.85	0.84
MAP3K4	0.85	0.85

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.72	-0.64
AF347015.31	-0.65	-0.58
C1orf54	-0.65	-0.67
GNG11	-0.65	-0.62
HIGD1B	-0.64	-0.58
MT-CO2	-0.63	-0.56
VAMP5	-0.63	-0.61
IL32	-0.63	-0.57
PLA2G5	-0.61	-0.57
METRN	-0.61	-0.58

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003676	nucleic acid binding	IEA		-
GO:0003700	transcription factor activity	IEA		-
GO:0003723	RNA binding	TAS		8084618
GO:0005516	calmodulin binding	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0009986	cell surface	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTL6A	ACTL6 \| Arp4 \| BAF53A \| INO80K \| MGC5382	actin-like 6A	Two-hybrid	BioGRID	16189514
AGT	ANHU \| FLJ92595 \| FLJ97926 \| SERPINA8	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	Two-hybrid	BioGRID	16189514
ARHGDIA	GDIA1 \| MGC117248 \| RHOGDI \| RHOGDI-1	Rho GDP dissociation inhibitor (GDI) alpha	Affinity Capture-MS	BioGRID	17353931
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	Two-hybrid	BioGRID	16189514
BARD1	-	BRCA1 associated RING domain 1	-	HPRD,BioGRID	12183411
BNIP3L	BNIP3a \| NIX	BCL2/adenovirus E1B 19kDa interacting protein 3-like	Two-hybrid	BioGRID	16189514
BTK	AGMX1 \| AT \| ATK \| BPK \| IMD1 \| MGC126261 \| MGC126262 \| PSCTK1 \| XLA	Bruton agammaglobulinemia tyrosine kinase	-	HPRD,BioGRID	9201297
C10orf12	DKFZp564P1916 \| FLJ13022	chromosome 10 open reading frame 12	Two-hybrid	BioGRID	16189514
C11orf16	-	chromosome 11 open reading frame 16	Two-hybrid	BioGRID	16189514
C18orf10	DKFZp586M1523 \| HMFN0601 \| HsT3006 \| L17 \| PGs2	chromosome 18 open reading frame 10	Two-hybrid	BioGRID	16189514
C19orf50	FLJ25480 \| MGC2749 \| MST096 \| MSTP096	chromosome 19 open reading frame 50	Two-hybrid	BioGRID	16189514
C19orf57	MGC11271 \| MGC149720	chromosome 19 open reading frame 57	Two-hybrid	BioGRID	16189514
C1orf71	FLJ32001 \| MGC18089	chromosome 1 open reading frame 71	Two-hybrid	BioGRID	16189514
CALM1	CALML2 \| CAMI \| DD132 \| PHKD	calmodulin 1 (phosphorylase kinase, delta)	Reconstituted Complex	BioGRID	9341188
CCDC7	BioT2-A \| BioT2-B \| BioT2-C \| DKFZp686N0559 \| FLJ32762 \| RP11-479G22.1	coiled-coil domain containing 7	Two-hybrid	BioGRID	16189514
CCDC91	DKFZp779L1558 \| FLJ11088 \| HSD8 \| p56	coiled-coil domain containing 91	Two-hybrid	BioGRID	16189514
CD177	HNA2A \| NB1 \| PRV1	CD177 molecule	Two-hybrid	BioGRID	16189514
CD2BP2	FWP010 \| LIN1 \| Snu40 \| U5-52K	CD2 (cytoplasmic tail) binding protein 2	Affinity Capture-MS	BioGRID	17353931
CEACAM5	CD66e \| CEA \| DKFZp781M2392	carcinoembryonic antigen-related cell adhesion molecule 5	Two-hybrid	BioGRID	16189514
CETP	HDLCQ10	cholesteryl ester transfer protein, plasma	Two-hybrid	BioGRID	16189514
CFDP1	BCNT \| BUCENTAUR \| CP27 \| SWC5 \| Yeti \| p97	craniofacial development protein 1	Two-hybrid	BioGRID	16189514
CPSF6	CFIM \| CFIM68 \| HPBRII-4 \| HPBRII-7	cleavage and polyadenylation specific factor 6, 68kDa	Two-hybrid	BioGRID	16189514
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	-	HPRD,BioGRID	12459554
CUEDC2	C10orf66 \| MGC2491 \| bA18I14.5	CUE domain containing 2	Two-hybrid	BioGRID	16189514
CXADR	CAR \| HCAR	coxsackie virus and adenovirus receptor	Two-hybrid	BioGRID	16189514
DFFA	DFF-45 \| DFF1 \| ICAD	DNA fragmentation factor, 45kDa, alpha polypeptide	Two-hybrid	BioGRID	16189514
DMRTB1	-	DMRT-like family B with proline-rich C-terminal, 1	Two-hybrid	BioGRID	16189514
DNAJB3	HCG3 \| MGC26879	DnaJ (Hsp40) homolog, subfamily B, member 3	Two-hybrid	BioGRID	16189514
DYNLL2	DNCL1B \| Dlc2 \| MGC17810	dynein, light chain, LC8-type 2	Two-hybrid	BioGRID	16189514
ELAVL3	DKFZp547J036 \| HUC \| HUCL \| MGC20653 \| PLE21	ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)	Two-hybrid	BioGRID	16189514
ELAVL4	HUD \| PNEM	ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)	Two-hybrid	BioGRID	16189514
ELK1	-	ELK1, member of ETS oncogene family	Reconstituted Complex	BioGRID	9010223
FAM131C	C1orf117 \| FLJ36766 \| RP11-5P18.9	family with sequence similarity 131, member C	Two-hybrid	BioGRID	16189514
FASN	FAS \| MGC14367 \| MGC15706 \| OA-519	fatty acid synthase	Two-hybrid	BioGRID	16189514
FLJ12529	FLJ39024 \| MGC9315	pre-mRNA cleavage factor I, 59 kDa subunit	Two-hybrid	BioGRID	16189514
GNPDA1	GNPDA \| GNPI \| GPI \| HLN \| KIAA0060	glucosamine-6-phosphate deaminase 1	Two-hybrid	BioGRID	16189514
GPBP1L1	RP11-767N6.1 \| SP192	GC-rich promoter binding protein 1-like 1	Two-hybrid	BioGRID	16189514
GSK3B	-	glycogen synthase kinase 3 beta	Affinity Capture-MS	BioGRID	17353931
HERPUD1	HERP \| KIAA0025 \| Mif1 \| SUP	homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1	Two-hybrid	BioGRID	16189514
HMGA1	HMG-R \| HMGA1A \| HMGIY \| MGC12816 \| MGC4242 \| MGC4854	high mobility group AT-hook 1	Two-hybrid	BioGRID	16189514
ILK	DKFZp686F1765 \| P59	integrin-linked kinase	Affinity Capture-MS	BioGRID	17353931
KCNMB1	K(VCA)beta \| SLO-BETA \| hslo-beta	potassium large conductance calcium-activated channel, subfamily M, beta member 1	Two-hybrid	BioGRID	16189514
KEL	CD238 \| ECE3	Kell blood group, metallo-endopeptidase	Two-hybrid	BioGRID	16189514
KHDRBS2	FLJ38664 \| MGC26664 \| SLM-1 \| SLM1 \| bA535F17.1	KH domain containing, RNA binding, signal transduction associated 2	Two-hybrid	BioGRID	16189514
KRR1	HRB2 \| RIP-1	KRR1, small subunit (SSU) processome component, homolog (yeast)	Two-hybrid	BioGRID	16189514
LILRA3	CD85E \| HM31 \| HM43 \| ILT6 \| LIR-4 \| LIR4 \| e3	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	Two-hybrid	BioGRID	16189514
MAGEA11	MAGE-11 \| MAGE11 \| MAGEA-11 \| MGC10511	melanoma antigen family A, 11	Two-hybrid	BioGRID	16189514
MAPK1IP1L	C14orf32 \| MGC23138 \| MISS \| c14_5346	mitogen-activated protein kinase 1 interacting protein 1-like	Two-hybrid	BioGRID	16189514
MATK	CHK \| CTK \| DKFZp434N1212 \| HHYLTK \| HYL \| HYLTK \| Lsk \| MGC1708 \| MGC2101	megakaryocyte-associated tyrosine kinase	Two-hybrid	BioGRID	16189514
MDFI	I-MF \| I-mfa	MyoD family inhibitor	Two-hybrid	BioGRID	16189514
MNS1	FLJ11222 \| FLJ26051	meiosis-specific nuclear structural 1	Two-hybrid	BioGRID	16189514
MRPS18B	C6orf14 \| DKFZp564H0223 \| HSPC183 \| HumanS18a \| MRP-S18-2 \| MRPS18-2 \| PTD017 \| S18amt	mitochondrial ribosomal protein S18B	Two-hybrid	BioGRID	16189514
MSC	ABF-1 \| ABF1 \| MYOR \| bHLHa22	musculin (activated B-cell factor-1)	Two-hybrid	BioGRID	16189514
MTCP1	C6.1B	mature T-cell proliferation 1	Two-hybrid	BioGRID	16189514
MTMR9	C8orf9 \| DKFZp434K171 \| LIP-STYX \| MGC126672 \| MTMR8	myotubularin related protein 9	Two-hybrid	BioGRID	16189514
MVK	FLJ96772 \| LRBP \| MK \| MVLK	mevalonate kinase	Two-hybrid	BioGRID	16189514
MYL6	ESMLC \| LC17-GI \| LC17-NM \| LC17A \| LC17B \| MLC1SM \| MLC3NM \| MLC3SM	myosin, light chain 6, alkali, smooth muscle and non-muscle	Two-hybrid	BioGRID	16189514
MYO1F	-	myosin IF	Two-hybrid	BioGRID	16189514
MYOZ2	C4orf5 \| CS-1	myozenin 2	Two-hybrid	BioGRID	16189514
NBPF3	AE2 \| DKFZp434D177	neuroblastoma breakpoint family, member 3	Two-hybrid	BioGRID	16189514
NDUFB1	CI-SGDH \| MNLL	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa	Two-hybrid	BioGRID	16189514
NDUFV1	CI-51kD \| UQOR1	NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa	Two-hybrid	BioGRID	16189514
NLE1	FLJ10458 \| Nle	notchless homolog 1 (Drosophila)	Two-hybrid	BioGRID	16189514
NPPB	BNP	natriuretic peptide precursor B	Two-hybrid	BioGRID	16189514
NSUN4	MGC22960 \| RP4-603I14.2	NOL1/NOP2/Sun domain family, member 4	Two-hybrid	BioGRID	16189514
NTNG2	KIAA0625 \| KIAA1857 \| LHLL9381 \| Lmnt2 \| MGC21884 \| NTNG1 \| bA479K20.1	netrin G2	Two-hybrid	BioGRID	16189514
PDHX	DLDBP \| E3BP \| OPDX \| PDX1 \| proX	pyruvate dehydrogenase complex, component X	Two-hybrid	BioGRID	16189514
PGLS	6PGL	6-phosphogluconolactonase	Two-hybrid	BioGRID	16189514
PLSCR1	MMTRA1B	phospholipid scramblase 1	Two-hybrid	BioGRID	16189514
POLR2G	MGC138367 \| MGC138369 \| RPB7 \| hRPB19 \| hsRPB7	polymerase (RNA) II (DNA directed) polypeptide G	-	HPRD	9704926
POU4F1	BRN3A \| FLJ13449 \| Oct-T1 \| RDC-1	POU class 4 homeobox 1	-	HPRD,BioGRID	12432261
PRTFDC1	FLJ11888 \| HHGP	phosphoribosyl transferase domain containing 1	Two-hybrid	BioGRID	16189514
PRUNE2	A214N16.3 \| BMCC1 \| BNIPXL \| C9orf65 \| DKFZp762K117 \| FLJ50060 \| FLJ54876 \| FLJ59118 \| KIAA0367 \| RP11-58J3.2 \| bA214N16.3	prune homolog 2 (Drosophila)	Two-hybrid	BioGRID	16189514
PTK2B	CADTK \| CAKB \| FADK2 \| FAK2 \| FRNK \| PKB \| PTK \| PYK2 \| RAFTK	PTK2B protein tyrosine kinase 2 beta	-	HPRD,BioGRID	10322114
PUF60	FIR \| FLJ31379 \| RoBPI \| SIAHBP1	poly-U binding splicing factor 60KDa	Affinity Capture-MS	BioGRID	17353931
RAB37	FLJ30284 \| FLJ32507	RAB37, member RAS oncogene family	Two-hybrid	BioGRID	16189514
RAD23A	HHR23A \| MGC111083	RAD23 homolog A (S. cerevisiae)	Two-hybrid	BioGRID	16189514
RALYL	HNRPCL3	RALY RNA binding protein-like	Two-hybrid	BioGRID	16189514
RASL11B	MGC2827 \| MGC4499	RAS-like, family 11, member B	Two-hybrid	BioGRID	16189514
RBPMS	HERMES	RNA binding protein with multiple splicing	Two-hybrid	BioGRID	16189514
RHOXF2	PEPP-2 \| PEPP2 \| THG1	Rhox homeobox family, member 2	Two-hybrid	BioGRID	16189514
RMND5B	DKFZp434K0926 \| FLJ22318	required for meiotic nuclear division 5 homolog B (S. cerevisiae)	Two-hybrid	BioGRID	16189514
RNF183	FLJ31197 \| MGC4734	ring finger protein 183	Two-hybrid	BioGRID	16189514
RP4-691N24.1	FLJ11792 \| KIAA0980 \| NLP \| dJ691N24.1	ninein-like	Two-hybrid	BioGRID	16189514
RPL31	MGC88191	ribosomal protein L31	Two-hybrid	BioGRID	16189514
RPS15A	FLJ27457 \| MGC111208 \| S15a	ribosomal protein S15a	Two-hybrid	BioGRID	16189514
SALL2	FLJ10414 \| FLJ55746 \| HSAL2 \| KIAA0360 \| ZNF795 \| p150(Sal2)	sal-like 2 (Drosophila)	Two-hybrid	BioGRID	16189514
SELI	KIAA1724	selenoprotein I	Two-hybrid	BioGRID	16189514
SERP2	C13orf21 \| MGC35505 \| RP11-269C23.1 \| bA269C23.1	stress-associated endoplasmic reticulum protein family member 2	Two-hybrid	BioGRID	16189514
SF1	D11S636 \| ZFM1 \| ZNF162	splicing factor 1	-	HPRD,BioGRID	9660765
SLC1A1	EAAC1 \| EAAT3	solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1	Two-hybrid	BioGRID	16189514
SLC22A24	MGC34821	solute carrier family 22, member 24	Two-hybrid	BioGRID	16189514
SMAD4	DPC4 \| JIP \| MADH4	SMAD family member 4	Two-hybrid	BioGRID	16189514
SMNDC1	SMNR \| SPF30	survival motor neuron domain containing 1	Affinity Capture-MS	BioGRID	17353931
SNRPC	FLJ20302	small nuclear ribonucleoprotein polypeptide C	-	HPRD,BioGRID	10827180
SSBP2	DKFZp686F03273 \| HSPC116	single-stranded DNA binding protein 2	Two-hybrid	BioGRID	16189514
SUV39H2	FLJ23414 \| KMT1B	suppressor of variegation 3-9 homolog 2 (Drosophila)	Two-hybrid	BioGRID	16189514
TAF1	BA2R \| CCG1 \| CCGS \| DYT3 \| KAT4 \| N-TAF1 \| NSCL2 \| OF \| P250 \| TAF2A \| TAFII250	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	-	HPRD	9488465
TMSB4Y	MGC26307 \| TB4Y	thymosin beta 4, Y-linked	Two-hybrid	BioGRID	16189514
TRIM37	KIAA0898 \| MUL \| POB1 \| TEF3	tripartite motif-containing 37	Two-hybrid	BioGRID	16189514
TRPV5	CAT2 \| ECAC1 \| OTRPC3	transient receptor potential cation channel, subfamily V, member 5	Two-hybrid	BioGRID	16189514
TSPAN3	TM4-A \| TM4SF8 \| TSPAN-3	tetraspanin 3	Two-hybrid	BioGRID	16189514
TULP2	TUBL2	tubby like protein 2	Two-hybrid	BioGRID	16189514
VPS72	CFL1 \| Swc2 \| TCFL1 \| YL-1 \| YL1	vacuolar protein sorting 72 homolog (S. cerevisiae)	Two-hybrid	BioGRID	16189514
WDR37	FLJ40354 \| KIAA0982 \| RP11-529L18.2	WD repeat domain 37	Two-hybrid	BioGRID	16189514
WWP1	AIP5 \| DKFZp434D2111 \| Tiul1 \| hSDRP1	WW domain containing E3 ubiquitin protein ligase 1	Two-hybrid	BioGRID	16189514
WWP2	AIP2 \| WWp2-like	WW domain containing E3 ubiquitin protein ligase 2	Two-hybrid	BioGRID	16189514
YY1AP1	FLJ10875 \| FLJ13914 \| HCCA1 \| HCCA2 \| YAP \| YY1AP	YY1 associated protein 1	Two-hybrid	BioGRID	16189514
ZDHHC3	DKFZp313D2314 \| FLJ20209 \| FLJ45940 \| GODZ \| ZNF373	zinc finger, DHHC-type containing 3	Two-hybrid	BioGRID	16189514
ZNF165	LD65 \| ZSCAN7	zinc finger protein 165	Affinity Capture-Western Two-hybrid	BioGRID	16189514

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID BARD1 PATHWAY	29	19	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP	404	246	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN	180	101	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 22	13	9	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP	309	199	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
MORI MATURE B LYMPHOCYTE DN	75	43	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS UP	145	91	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST DN	309	206	All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION DN	337	230	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA SUBGROUPS	30	20	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA UP	64	46	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP	390	242	All SZGR 2.0 genes in this pathway
JIANG VHL TARGETS	138	91	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS UP	425	253	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP	149	85	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP	442	263	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 12HR DN	33	25	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 24HR DN	43	32	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 32HR DN	39	28	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 48HR DN	40	29	All SZGR 2.0 genes in this pathway
JIANG HYPOXIA VIA VHL	34	24	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-299-5p	46	52	1A	hsa-miR-299-5p	UGGUUUACCGUCCCACAUACAU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EWSR1