SZGR2

Summary ?

GeneID	23499
Symbol	MACF1
Synonyms	ABP620\|ACF7\|MACF\|OFC4
Description	microtubule-actin crosslinking factor 1
Reference	MIM:608271\|HGNC:HGNC:13664\|Ensembl:ENSG00000127603\|HPRD:09750\|Vega:OTTHUMG00000007754
Gene type	protein-coding
Map location	1p32-p31
Pascal p-value	0.021
Sherlock p-value	0.912
Fetal beta	1.813
Support	STRUCTURAL PLASTICITY G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Darnell FMRP targets Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Xu_2012	Whole Exome Sequencing analysis	De novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.7115

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
MACF1	chr1	39904999	C	T	NM_012090	p.4033R>W	missense			Schizophrenia	DNM:Xu_2012

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003779	actin binding	IEA		-
GO:0005509	calcium ion binding	IEA		-
GO:0005509	calcium ion binding	NAS		-
GO:0005515	protein binding	IEA		-
GO:0005515	protein binding	IPI		17043677
GO:0004553	hydrolase activity, hydrolyzing O-glycosyl compounds	IEA		-
GO:0008017	microtubule binding	IEA		-
GO:0008017	microtubule binding	NAS		-
GO:0051015	actin filament binding	NAS		10529403 \|10559237
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001707	mesoderm formation	IEA		-
GO:0016055	Wnt receptor signaling pathway	IEA		-
GO:0005975	carbohydrate metabolic process	IEA		-
GO:0007163	establishment or maintenance of cell polarity	IEA		-
GO:0007050	cell cycle arrest	IEA		-
GO:0008150	biological_process	ND		-
GO:0006928	cell motion	IEA		-
GO:0006620	posttranslational protein targeting to membrane	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005856	cytoskeleton	IEA		-
GO:0005856	cytoskeleton	NAS		10529403
GO:0005737	cytoplasm	IDA		10559237
GO:0005737	cytoplasm	ISS		-
GO:0015630	microtubule cytoskeleton	IEA		-
GO:0015629	actin cytoskeleton	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
LAIHO COLORECTAL CANCER SERRATED UP	112	71	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL UP	95	64	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 DN	281	186	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION GRANULOCYTE UP	55	34	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP	207	128	All SZGR 2.0 genes in this pathway
EBAUER MYOGENIC TARGETS OF PAX3 FOXO1 FUSION	50	26	All SZGR 2.0 genes in this pathway
XU HGF SIGNALING NOT VIA AKT1 48HR UP	35	20	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
WOOD EBV EBNA1 TARGETS DN	47	33	All SZGR 2.0 genes in this pathway
DAIRKEE TERT TARGETS DN	124	79	All SZGR 2.0 genes in this pathway
KIM MYCN AMPLIFICATION TARGETS UP	92	64	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
ROPERO HDAC2 TARGETS	114	71	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
GEORGES CELL CYCLE MIR192 TARGETS	62	46	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
SAKAI TUMOR INFILTRATING MONOCYTES DN	81	51	All SZGR 2.0 genes in this pathway
MORI LARGE PRE BII LYMPHOCYTE DN	58	39	All SZGR 2.0 genes in this pathway
MORI MATURE B LYMPHOCYTE UP	90	62	All SZGR 2.0 genes in this pathway
YU MYC TARGETS DN	55	38	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR DN	86	62	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR DN	101	70	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
DURCHDEWALD SKIN CARCINOGENESIS DN	264	168	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
DE YY1 TARGETS DN	92	64	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN DN	249	165	All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1	91	75	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN	435	289	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR DN	185	116	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP	229	149	All SZGR 2.0 genes in this pathway
LINSLEY MIR16 TARGETS	206	127	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	126	132	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	126	132	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	126	132	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-138	943	950	1A,m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-142-5p	366	372	1A	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-15/16/195/424/497	640	646	1A	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-186	364	370	1A	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-19	557	564	1A,m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	557	564	1A,m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-192/215	254	260	1A	hsa-miR-192	CUGACCUAUGAAUUGACAGCC
miR-192/215	254	260	1A	hsa-miR-215	AUGACCUAUGAAUUGACAGAC
miR-217	1180	1186	1A	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-23	163	169	1A	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	163	169	1A	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-25/32/92/363/367	587	593	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-377	1084	1090	m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-379	1129	1135	1A	hsa-miR-379^brain	UGGUAGACUAUGGAACGUA
miR-409-5p	197	203	m8	hsa-miR-409-5p	AGGUUACCCGAGCAACUUUGCA
miR-410	83	89	m8	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-421	1111	1117	1A	hsa-miR-421	GGCCUCAUUAAAUGUUUGUUG
miR-503	640	646	1A	hsa-miR-503	UAGCAGCGGGAACAGUUCUGCAG
miR-544	1115	1121	1A	hsa-miR-544	AUUCUGCAUUUUUAGCAAGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MACF1