Gene Page: GAD2
Summary ?
GeneID | 2572 |
Symbol | GAD2 |
Synonyms | GAD65 |
Description | glutamate decarboxylase 2 |
Reference | MIM:138275|HGNC:HGNC:4093|Ensembl:ENSG00000136750|HPRD:11817|Vega:OTTHUMG00000017836 |
Gene type | protein-coding |
Map location | 10p11.23 |
Pascal p-value | 0.829 |
Sherlock p-value | 0.86 |
Fetal beta | -2.564 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 5 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0384 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs12543503 | chr8 | 95811983 | GAD2 | 2572 | 0.07 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](/SZGR/GeneImg/GAD2_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
CLCN7 | 0.80 | 0.86 |
DNAJB12 | 0.80 | 0.83 |
ATG2A | 0.78 | 0.83 |
RAB36 | 0.78 | 0.76 |
RNF123 | 0.77 | 0.83 |
ZNF335 | 0.77 | 0.86 |
C2orf18 | 0.77 | 0.82 |
DPP9 | 0.76 | 0.83 |
SPG7 | 0.76 | 0.80 |
FLRT1 | 0.76 | 0.84 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.62 | -0.62 |
AF347015.31 | -0.56 | -0.55 |
MT-CO2 | -0.54 | -0.53 |
AF347015.8 | -0.53 | -0.52 |
MT-CYB | -0.52 | -0.50 |
AF347015.27 | -0.52 | -0.53 |
C1orf54 | -0.50 | -0.55 |
CLEC2B | -0.50 | -0.56 |
AF347015.33 | -0.49 | -0.47 |
AL139819.3 | -0.49 | -0.55 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004351 | glutamate decarboxylase activity | IEA | glutamate (GO term level: 6) | - |
GO:0005515 | protein binding | IPI | 10671565 | |
GO:0016829 | lyase activity | IEA | - | |
GO:0016831 | carboxy-lyase activity | IEA | - | |
GO:0030170 | pyridoxal phosphate binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 8954991 |
GO:0006540 | glutamate decarboxylation to succinate | TAS | GABA, glutamate, Brain, Neurotransmitter (GO term level: 10) | 1549570 |
GO:0042136 | neurotransmitter biosynthetic process | IEA | neuron, axon, Synap, Neurotransmitter (GO term level: 9) | - |
GO:0019752 | carboxylic acid metabolic process | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030424 | axon | IEA | neuron, axon, Neurotransmitter (GO term level: 6) | - |
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0000139 | Golgi membrane | IEA | - | |
GO:0005794 | Golgi apparatus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0030054 | cell junction | IEA | - | |
GO:0031410 | cytoplasmic vesicle | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ALANINE ASPARTATE AND GLUTAMATE METABOLISM | 32 | 26 | All SZGR 2.0 genes in this pathway |
KEGG BETA ALANINE METABOLISM | 22 | 16 | All SZGR 2.0 genes in this pathway |
KEGG TAURINE AND HYPOTAURINE METABOLISM | 10 | 7 | All SZGR 2.0 genes in this pathway |
KEGG BUTANOATE METABOLISM | 34 | 20 | All SZGR 2.0 genes in this pathway |
KEGG TYPE I DIABETES MELLITUS | 44 | 38 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES | 186 | 155 | All SZGR 2.0 genes in this pathway |
REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
REACTOME NEUROTRANSMITTER RELEASE CYCLE | 34 | 30 | All SZGR 2.0 genes in this pathway |
REACTOME GABA SYNTHESIS RELEASE REUPTAKE AND DEGRADATION | 17 | 16 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
SCHLESINGER H3K27ME3 IN NORMAL AND METHYLATED IN CANCER | 28 | 21 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
MCCLUNG DELTA FOSB TARGETS 8WK | 47 | 38 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK UP | 244 | 151 | All SZGR 2.0 genes in this pathway |
XU GH1 EXOGENOUS TARGETS DN | 120 | 69 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
LABBE TARGETS OF TGFB1 AND WNT3A UP | 111 | 70 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
LIU VAV3 PROSTATE CARCINOGENESIS DN | 17 | 14 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
ALFANO MYC TARGETS | 239 | 156 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 325 | 331 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-485-3p | 493 | 499 | m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.