Gene Page: HHEX
Summary ?
GeneID | 3087 |
Symbol | HHEX |
Synonyms | HEX|HMPH|HOX11L-PEN|PRH|PRHX |
Description | hematopoietically expressed homeobox |
Reference | MIM:604420|HGNC:HGNC:4901|Ensembl:ENSG00000152804|HPRD:06829|Vega:OTTHUMG00000018762 |
Gene type | protein-coding |
Map location | 10q23.33 |
Pascal p-value | 0.36 |
Fetal beta | -0.079 |
DMG | 2 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg18599843 | 10 | 94450994 | HHEX | 5.644E-4 | 0.337 | 0.049 | DMG:Wockner_2014 |
cg12865381 | 10 | 94459447 | HHEX | 4.97E-9 | -0.017 | 2.84E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
HLA-B | 0.85 | 0.76 |
BST2 | 0.83 | 0.63 |
IFI6 | 0.82 | 0.65 |
TAP1 | 0.81 | 0.72 |
ISG15 | 0.80 | 0.60 |
HLA-G | 0.79 | 0.58 |
PARP12 | 0.77 | 0.67 |
TNFRSF1A | 0.77 | 0.68 |
SLC15A3 | 0.77 | 0.68 |
IFITM1 | 0.76 | 0.63 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RTF1 | -0.51 | -0.59 |
CCAR1 | -0.50 | -0.60 |
ZNF485 | -0.48 | -0.58 |
DNAJC2 | -0.48 | -0.54 |
ZNF841 | -0.48 | -0.56 |
THOC2 | -0.48 | -0.59 |
UPF3B | -0.48 | -0.59 |
TCERG1 | -0.48 | -0.54 |
NOP58 | -0.48 | -0.55 |
GGNBP2 | -0.48 | -0.55 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | TAS | 10871399 | |
GO:0008134 | transcription factor binding | IPI | 15016828 | |
GO:0008190 | eukaryotic initiation factor 4E binding | IDA | 12554669 | |
GO:0016564 | transcription repressor activity | ISS | - | |
GO:0043565 | sequence-specific DNA binding | ISS | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030900 | forebrain development | IEA | Brain (GO term level: 8) | - |
GO:0001889 | liver development | IEA | - | |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006406 | mRNA export from nucleus | IDA | 12554669 | |
GO:0010553 | negative regulation of specific transcription from RNA polymerase II promoter | IDA | 10871399 |15016828 | |
GO:0010552 | positive regulation of specific transcription from RNA polymerase II promoter | IDA | 12655000 | |
GO:0009952 | anterior/posterior pattern formation | ISS | - | |
GO:0007049 | cell cycle | IDA | 12554669 | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030177 | positive regulation of Wnt receptor signaling pathway | ISS | - | |
GO:0030154 | cell differentiation | IEA | - | |
GO:0016525 | negative regulation of angiogenesis | IDA | 15016828 | |
GO:0042127 | regulation of cell proliferation | IEA | - | |
GO:0030948 | negative regulation of vascular endothelial growth factor receptor signaling pathway | IDA | 15016828 | |
GO:0030878 | thyroid gland development | IEA | - | |
GO:0035050 | embryonic heart tube development | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | ISS | - | |
GO:0005737 | cytoplasm | IDA | 12554669 |12826010 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG MATURITY ONSET DIABETES OF THE YOUNG | 25 | 19 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA DN | 284 | 156 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA DN | 146 | 94 | All SZGR 2.0 genes in this pathway |
ELVIDGE HIF1A TARGETS UP | 67 | 40 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL UP | 316 | 190 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER DN | 232 | 154 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 6 | 84 | 54 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
LUI THYROID CANCER CLUSTER 1 | 51 | 33 | All SZGR 2.0 genes in this pathway |
HERNANDEZ MITOTIC ARREST BY DOCETAXEL 2 UP | 64 | 45 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE DN | 165 | 104 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BENPORATH NOS TARGETS | 179 | 105 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
SHIN B CELL LYMPHOMA CLUSTER 3 | 28 | 23 | All SZGR 2.0 genes in this pathway |
BASSO B LYMPHOCYTE NETWORK | 143 | 96 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS B LYMPHOCYTE DN | 38 | 25 | All SZGR 2.0 genes in this pathway |
FERRANDO LYL1 NEIGHBORS | 15 | 12 | All SZGR 2.0 genes in this pathway |
THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA DN | 41 | 27 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
MCCOLLUM GELDANAMYCIN RESISTANCE DN | 7 | 6 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR UP | 174 | 96 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL DN | 216 | 143 | All SZGR 2.0 genes in this pathway |
LABBE WNT3A TARGETS UP | 112 | 71 | All SZGR 2.0 genes in this pathway |
ZHOU PANCREATIC EXOCRINE PROGENITOR | 11 | 10 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS UP | 491 | 316 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
SCHOEN NFKB SIGNALING | 34 | 26 | All SZGR 2.0 genes in this pathway |
LI INDUCED T TO NATURAL KILLER UP | 307 | 182 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
HUANG GATA2 TARGETS UP | 149 | 96 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE VIA P38 COMPLETE | 227 | 151 | All SZGR 2.0 genes in this pathway |
SMIRNOV RESPONSE TO IR 6HR DN | 114 | 69 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-223 | 671 | 677 | m8 | hsa-miR-223 | UGUCAGUUUGUCAAAUACCCC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.