Gene Page: APBB2
Summary ?
| GeneID | 323 |
| Symbol | APBB2 |
| Synonyms | FE65L|FE65L1 |
| Description | amyloid beta precursor protein binding family B member 2 |
| Reference | MIM:602710|HGNC:HGNC:582|Ensembl:ENSG00000163697|HPRD:04088|Vega:OTTHUMG00000160416 |
| Gene type | protein-coding |
| Map location | 4p13 |
| Pascal p-value | 0.953 |
| Fetal beta | 0.768 |
| DMG | 1 (# studies) |
| eGene | Cerebellar Hemisphere Cerebellum |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg07291349 | 4 | 40964962 | APBB2 | 6.75E-7 | 0.539 | 0.007 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AL360181.5 | 0.49 | 0.40 |
| PCBP3 | 0.49 | 0.38 |
| ESYT3 | 0.49 | 0.41 |
| ABCA7 | 0.48 | 0.42 |
| KCNH6 | 0.48 | 0.41 |
| SPTBN5 | 0.48 | 0.40 |
| SOX13 | 0.47 | 0.46 |
| MYH15 | 0.46 | 0.45 |
| EPS8L2 | 0.46 | 0.45 |
| SPATA20 | 0.46 | 0.40 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| PPAPR5 | -0.25 | -0.21 |
| ZNF238 | -0.25 | -0.19 |
| NEUROD6 | -0.25 | -0.26 |
| KLHL1 | -0.25 | -0.17 |
| RPL5 | -0.24 | -0.25 |
| RPL35A | -0.24 | -0.34 |
| DACT1 | -0.24 | -0.17 |
| RPL38 | -0.24 | -0.35 |
| GPR22 | -0.24 | -0.22 |
| AC005768.1 | -0.24 | -0.20 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0001540 | beta-amyloid binding | ISS | - | |
| GO:0008134 | transcription factor binding | ISS | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007242 | intracellular signaling cascade | NAS | 8855266 | |
| GO:0007050 | cell cycle arrest | ISS | - | |
| GO:0030308 | negative regulation of cell growth | ISS | - | |
| GO:0045749 | negative regulation of S phase of mitotic cell cycle | ISS | - | |
| GO:0045449 | regulation of transcription | ISS | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0030426 | growth cone | ISS | axon, dendrite (GO term level: 5) | - |
| GO:0045202 | synapse | ISS | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
| GO:0005634 | nucleus | ISS | - | |
| GO:0016020 | membrane | NAS | 8855266 | |
| GO:0030027 | lamellipodium | ISS | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| HOLLMANN APOPTOSIS VIA CD40 DN | 267 | 178 | All SZGR 2.0 genes in this pathway |
| ZHONG RESPONSE TO AZACITIDINE AND TSA UP | 183 | 119 | All SZGR 2.0 genes in this pathway |
| GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER ZNF217 AMPLIFIED UP | 78 | 48 | All SZGR 2.0 genes in this pathway |
| PEPPER CHRONIC LYMPHOCYTIC LEUKEMIA DN | 21 | 8 | All SZGR 2.0 genes in this pathway |
| HUMMEL BURKITTS LYMPHOMA UP | 43 | 27 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS 8HR DN | 129 | 84 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS 12HR DN | 209 | 122 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| VANHARANTA UTERINE FIBROID WITH 7Q DELETION DN | 36 | 23 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 XPCS DN | 88 | 71 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| YANG BREAST CANCER ESR1 UP | 36 | 22 | All SZGR 2.0 genes in this pathway |
| YANG BREAST CANCER ESR1 LASER UP | 34 | 25 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED WELL VS MODERATELY DN | 110 | 64 | All SZGR 2.0 genes in this pathway |
| SMITH TERT TARGETS UP | 145 | 91 | All SZGR 2.0 genes in this pathway |
| PEART HDAC PROLIFERATION CLUSTER UP | 57 | 35 | All SZGR 2.0 genes in this pathway |
| PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN | 162 | 102 | All SZGR 2.0 genes in this pathway |
| PETROVA PROX1 TARGETS DN | 64 | 38 | All SZGR 2.0 genes in this pathway |
| WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
| LEE AGING MUSCLE DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
| MARIADASON RESPONSE TO BUTYRATE SULINDAC 4 | 21 | 12 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS 7 | 51 | 34 | All SZGR 2.0 genes in this pathway |
| SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
| RIGGINS TAMOXIFEN RESISTANCE DN | 220 | 147 | All SZGR 2.0 genes in this pathway |
| KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
| STEARMAN LUNG CANCER EARLY VS LATE UP | 125 | 89 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING | 246 | 152 | All SZGR 2.0 genes in this pathway |
| TOOKER GEMCITABINE RESISTANCE DN | 122 | 84 | All SZGR 2.0 genes in this pathway |
| PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP | 134 | 85 | All SZGR 2.0 genes in this pathway |
| KIM PTEN TARGETS UP | 18 | 9 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 795 | 801 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 795 | 801 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-141/200a | 131 | 138 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-153 | 913 | 919 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| miR-17-5p/20/93.mr/106/519.d | 409 | 415 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
| hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
| hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
| hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
| hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
| hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
| miR-22 | 813 | 819 | 1A | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
| miR-31 | 157 | 164 | 1A,m8 | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCUG |
| miR-330 | 97 | 103 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
| miR-448 | 912 | 919 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
| miR-542-3p | 381 | 388 | 1A,m8 | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.