SZGR2

Summary ?

GeneID	3643
Symbol	INSR
Synonyms	CD220\|HHF5
Description	insulin receptor
Reference	MIM:147670\|HGNC:HGNC:6091\|Ensembl:ENSG00000171105\|HPRD:00975\|Vega:OTTHUMG00000181992
Gene type	protein-coding
Map location	19p13.3-p13.2
Pascal p-value	0.009
Fetal beta	0.407
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0449

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg13976219	19	7197166	INSR	4.646E-4	-0.233	0.046	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs2860173	chr19	7129085	INSR	3643		0.13		cis

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004714	transmembrane receptor protein tyrosine kinase activity	IEA	neurite (GO term level: 8)	-
GO:0000166	nucleotide binding	IEA		-
GO:0004872	receptor activity	IEA		-
GO:0004716	receptor signaling protein tyrosine kinase activity	IDA		6849137
GO:0005159	insulin-like growth factor receptor binding	IDA		8452530
GO:0005009	insulin receptor activity	IDA		8440175
GO:0005524	ATP binding	IEA		-
GO:0005525	GTP binding	IDA		9092559
GO:0016740	transferase activity	IEA		-
GO:0042169	SH2 domain binding	IPI		8276809
GO:0031994	insulin-like growth factor I binding	IPI		8452530
GO:0031995	insulin-like growth factor II binding	IPI		12138094
GO:0043548	phosphoinositide 3-kinase binding	IPI		7537849 \|8276809
GO:0043559	insulin binding	IDA		8440175
GO:0043560	insulin receptor substrate binding	IPI		7537849 \|7559478
GO:0051425	PTB domain binding	IPI		7559478
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000187	activation of MAPK activity	IMP		17001305
GO:0003007	heart morphogenesis	IMP		7693131
GO:0030238	male sex determination	IEA		-
GO:0007186	G-protein coupled receptor protein signaling pathway	IDA		9092559
GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	IEA		-
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0005975	carbohydrate metabolic process	IEA		-
GO:0008286	insulin receptor signaling pathway	IDA		8440175
GO:0042593	glucose homeostasis	IMP		7693131
GO:0032583	regulation of gene-specific transcription	IMP		12881524
GO:0019087	transformation of host cell by virus	IMP		17001305
GO:0051290	protein heterotetramerization	IDA		1898103
GO:0030335	positive regulation of cell migration	IMP		12138094
GO:0045740	positive regulation of DNA replication	IMP		12138094
GO:0045821	positive regulation of glycolysis	IMP		7693131
GO:0045995	regulation of embryonic development	IMP		7693131
GO:0046777	protein amino acid autophosphorylation	IMP		7537849
GO:0048639	positive regulation of developmental growth	IMP		7693131
GO:0045429	positive regulation of nitric oxide biosynthetic process	IMP		10747347
GO:0060267	positive regulation of respiratory burst	IDA		9092559
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005792	microsome	IDA		8452530
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0005901	caveola	IDA		15182363
GO:0005886	plasma membrane	EXP		2986535
GO:0005886	plasma membrane	IEA		-
GO:0005887	integral to plasma membrane	IDA		9092559
GO:0010008	endosome membrane	EXP		2986535

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACP1	HAAP \| MGC111030 \| MGC3499	acid phosphatase 1, soluble	-	HPRD	1304913
AHSG	A2HS \| AHS \| FETUA \| HSGA	alpha-2-HS-glycoprotein	-	HPRD,BioGRID	7906861
CAV1	CAV \| MSTP085 \| VIP21	caveolin 1, caveolae protein, 22kDa	-	HPRD,BioGRID	10598578
CSK	MGC117393	c-src tyrosine kinase	CSK interacts with IR.	BIND	10026153
CSK	MGC117393	c-src tyrosine kinase	-	HPRD,BioGRID	10026153
DOK5	C20orf180 \| MGC16926	docking protein 5	-	HPRD	12730241
ENPP1	M6S1 \| NPP1 \| NPPS \| PC-1 \| PCA1 \| PDNP1	ectonucleotide pyrophosphatase/phosphodiesterase 1	-	HPRD,BioGRID	10615944
FRS2	FRS2A \| FRS2alpha \| SNT \| SNT-1 \| SNT1	fibroblast growth factor receptor substrate 2	-	HPRD,BioGRID	10650943
GAB1	-	GRB2-associated binding protein 1	Two-hybrid	BioGRID	9658397
GRB10	GRB-IR \| Grb-10 \| IRBP \| KIAA0207 \| MEG1 \| RSS	growth factor receptor-bound protein 10	Grb10 interacts with IR.	BIND	9506989
GRB10	GRB-IR \| Grb-10 \| IRBP \| KIAA0207 \| MEG1 \| RSS	growth factor receptor-bound protein 10	-	HPRD,BioGRID	7479769 \|8621530
GRB14	-	growth factor receptor-bound protein 14	-	HPRD,BioGRID	9748281 \|11726652
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	Affinity Capture-Western	BioGRID	9083103
GRB7	-	growth factor receptor-bound protein 7	-	HPRD,BioGRID	10803466
HMGA1	HMG-R \| HMGA1A \| HMGIY \| MGC12816 \| MGC4242 \| MGC4854	high mobility group AT-hook 1	HMGA1 interacts with INSR locus.	BIND	15924147
HRAS	C-BAS/HAS \| C-H-RAS \| C-HA-RAS1 \| CTLO \| H-RASIDX \| HAMSV \| HRAS1 \| K-RAS \| N-RAS \| RASH1	v-Ha-ras Harvey rat sarcoma viral oncogene homolog	-	HPRD,BioGRID	3109943
IGF2	C11orf43 \| FLJ22066 \| FLJ44734 \| INSIGF \| pp9974	insulin-like growth factor 2 (somatomedin A)	-	HPRD,BioGRID	9722981
INPPL1	SHIP2	inositol polyphosphate phosphatase-like 1	Affinity Capture-Western	BioGRID	12504111
INS	ILPR \| IRDN	insulin	-	HPRD	2550426
INSRR	IRR	insulin receptor-related receptor	-	HPRD,BioGRID	8916919
IRS1	HIRS-1	insulin receptor substrate 1	IRS-1 interacts with IR. This interaction was modeled on a demonstrated interaction between rat IRS-1 and human IR.	BIND	10026153
IRS1	HIRS-1	insulin receptor substrate 1	Insulin Receptor Substrate-1 Binds to the Insulin Receptor. This interaction is modeled on demonstrated interaction between human IR and rat IRS-1	BIND	8626379
IRS1	HIRS-1	insulin receptor substrate 1	-	HPRD,BioGRID	11606564
IRS2	-	insulin receptor substrate 2	-	HPRD,BioGRID	8626379
IRS2	-	insulin receptor substrate 2	Insulin Receptor Substrate-2 Binds to the Insulin Receptor. This interaction is modeled on demonstrated interaction between human IR and murine IRS-2.	BIND	8626379
JAK1	JAK1A \| JAK1B \| JTK3	Janus kinase 1 (a protein tyrosine kinase)	Phosphorylated IR-beta interacts with JAK-1.	BIND	9492017
KHDRBS1	FLJ34027 \| Sam68 \| p62	KH domain containing, RNA binding, signal transduction associated 1	Affinity Capture-Western	BioGRID	11604231
MAPK1	ERK \| ERK2 \| ERT1 \| MAPK2 \| P42MAPK \| PRKM1 \| PRKM2 \| p38 \| p40 \| p41 \| p41mapk	mitogen-activated protein kinase 1	Affinity Capture-Western	BioGRID	11409918
MAPK3	ERK1 \| HS44KDAP \| HUMKER1A \| MGC20180 \| P44ERK1 \| P44MAPK \| PRKM3	mitogen-activated protein kinase 3	-	HPRD,BioGRID	11409918
NAMPT	1110035O14Rik \| DKFZp666B131 \| MGC117256 \| PBEF \| PBEF1 \| VF \| VISFATIN	nicotinamide phosphoribosyltransferase	PBEF interacts with IR.	BIND	15604363
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	INSR (IR) interacts with PIK3R1. This interaction was modeled on a demonstrated interaction between INSR and PIK3R1 from unspecified species.	BIND	15735664
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	The insulin receptor (IR) interacts with p85-alpha.	BIND	8603569
PIK3R3	DKFZp686P05226 \| FLJ41892 \| p55 \| p55-GAMMA	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)	-	HPRD,BioGRID	9524259
PRKCD	MAY1 \| MGC49908 \| PKCD \| nPKC-delta	protein kinase C, delta	-	HPRD,BioGRID	11266508
PTPN1	PTP1B	protein tyrosine phosphatase, non-receptor type 1	-	HPRD,BioGRID	8826975
PTPN11	BPTP3 \| CFC \| MGC14433 \| NS1 \| PTP-1D \| PTP2C \| SH-PTP2 \| SH-PTP3 \| SHP2	protein tyrosine phosphatase, non-receptor type 11	-	HPRD,BioGRID	7493946 \|8135823
PTPN12	PTP-PEST \| PTPG1	protein tyrosine phosphatase, non-receptor type 12	-	HPRD,BioGRID	8454633
PTPN6	HCP \| HCPH \| HPTP1C \| PTP-1C \| SH-PTP1 \| SHP-1 \| SHP-1L \| SHP1	protein tyrosine phosphatase, non-receptor type 6	-	HPRD,BioGRID	7512963
PTPRF	FLJ43335 \| FLJ45062 \| FLJ45567 \| LAR	protein tyrosine phosphatase, receptor type, F	-	HPRD,BioGRID	1321126
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	-	HPRD	11409918
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	-	HPRD,BioGRID	1331107
SH2B1	DKFZp547G1110 \| FLJ30542 \| KIAA1299 \| SH2-B \| SH2B	SH2B adaptor protein 1	-	HPRD,BioGRID	9742218 \|10594240
SH2B2	APS	SH2B adaptor protein 2	-	HPRD	10196204
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD	9083103
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	Tyrosine-phosphorylated IR interacts with Shc. This interaction was modeled on a demonstrated interaction between human IR and Shc from an unspecified species.	BIND	10340378
SMAD2	JV18 \| JV18-1 \| MADH2 \| MADR2 \| MGC22139 \| MGC34440 \| hMAD-2 \| hSMAD2	SMAD family member 2	-	HPRD,BioGRID	9092546
SNX1	HsT17379 \| MGC8664 \| SNX1A \| Vps5	sorting nexin 1	-	HPRD,BioGRID	9819414
SNX2	MGC5204 \| TRG-9	sorting nexin 2	-	HPRD,BioGRID	9819414
SNX4	-	sorting nexin 4	-	HPRD,BioGRID	9819414
SNX6	MGC3157 \| MSTP010 \| TFAF2	sorting nexin 6	-	HPRD,BioGRID	11279102
SOCS1	CIS1 \| CISH1 \| JAB \| SOCS-1 \| SSI-1 \| SSI1 \| TIP3	suppressor of cytokine signaling 1	Suppressors of cytokine signaling-1 associates with and inhibits the insulin receptor.	BIND	11342531
SOCS3	ATOD4 \| CIS3 \| Cish3 \| MGC71791 \| SOCS-3 \| SSI-3 \| SSI3	suppressor of cytokine signaling 3	-	HPRD,BioGRID	11071852 \|12560330
SOCS6	CIS4 \| HSPC060 \| SOCS4 \| SSI4 \| STAI4 \| STATI4	suppressor of cytokine signaling 6	Suppressors of cytokine signaling-6 associates with and inhibits the insulin receptor. This interaction is modeled on demonstrated interaction between human IR and murine SOCS-6.	BIND	11342531
SORBS1	CAP \| DKFZp451C066 \| DKFZp586P1422 \| FLAF2 \| FLJ12406 \| KIAA1296 \| R85FL \| SH3D5 \| SH3P12 \| SORB1	sorbin and SH3 domain containing 1	-	HPRD,BioGRID	11374898
SYNCRIP	GRY-RBP \| HNRPQ1 \| NSAP1 \| RP1-3J17.2 \| dJ3J17.2 \| hnRNP-Q \| pp68	synaptotagmin binding, cytoplasmic RNA interacting protein	-	HPRD,BioGRID	11994298
VAV1	VAV	vav 1 guanine nucleotide exchange factor	-	HPRD,BioGRID	7535775
VAV3	FLJ40431	vav 3 guanine nucleotide exchange factor	-	HPRD,BioGRID	11094073

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ADHERENS JUNCTION	75	53	All SZGR 2.0 genes in this pathway
KEGG INSULIN SIGNALING PATHWAY	137	103	All SZGR 2.0 genes in this pathway
KEGG TYPE II DIABETES MELLITUS	47	41	All SZGR 2.0 genes in this pathway
KEGG ALDOSTERONE REGULATED SODIUM REABSORPTION	42	29	All SZGR 2.0 genes in this pathway
BIOCARTA HDAC PATHWAY	32	25	All SZGR 2.0 genes in this pathway
BIOCARTA GH PATHWAY	28	22	All SZGR 2.0 genes in this pathway
BIOCARTA INSULIN PATHWAY	22	16	All SZGR 2.0 genes in this pathway
PID INSULIN PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID PTP1B PATHWAY	52	40	All SZGR 2.0 genes in this pathway
PID TCPTP PATHWAY	43	33	All SZGR 2.0 genes in this pathway
PID INSULIN GLUCOSE PATHWAY	26	24	All SZGR 2.0 genes in this pathway
REACTOME INSULIN RECEPTOR RECYCLING	23	9	All SZGR 2.0 genes in this pathway
REACTOME INSULIN RECEPTOR SIGNALLING CASCADE	87	64	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY INSULIN RECEPTOR	108	72	All SZGR 2.0 genes in this pathway
REACTOME SIGNAL ATTENUATION	14	8	All SZGR 2.0 genes in this pathway
REACTOME PI3K CASCADE	71	51	All SZGR 2.0 genes in this pathway
REACTOME SHC RELATED EVENTS	17	13	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN	116	79	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN	352	225	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP	380	236	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
WANG BARRETTS ESOPHAGUS AND ESOPHAGUS CANCER UP	26	12	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS	205	145	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER DN	203	134	All SZGR 2.0 genes in this pathway
KIM MYCN AMPLIFICATION TARGETS DN	103	59	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
BENPORATH MYC TARGETS WITH EBOX	230	156	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
FERNANDEZ BOUND BY MYC	182	116	All SZGR 2.0 genes in this pathway
MANALO HYPOXIA UP	207	145	All SZGR 2.0 genes in this pathway
URS ADIPOCYTE DIFFERENTIATION UP	74	51	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
CHEN LVAD SUPPORT OF FAILING HEART UP	103	69	All SZGR 2.0 genes in this pathway
LU AGING BRAIN UP	262	186	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE	246	153	All SZGR 2.0 genes in this pathway
HILLION HMGA1 TARGETS	90	71	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
OUYANG PROSTATE CANCER MARKERS	19	16	All SZGR 2.0 genes in this pathway
LABBE TARGETS OF TGFB1 AND WNT3A DN	108	68	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER SURVIVAL UP	185	112	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S3	266	180	All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING DN	225	124	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G1 S	147	76	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP	504	321	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 UP	344	215	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
GUO TARGETS OF IRS1 AND IRS2	98	67	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP	279	155	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	2393	2400	1A,m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-128	194	200	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	194	200	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-15/16/195/424/497	577	583	m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-379	2391	2397	m8	hsa-miR-379^brain	UGGUAGACUAUGGAACGUA
miR-496	2323	2330	1A,m8	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: INSR