SZGR2

Summary ?

GeneID	4035
Symbol	LRP1
Synonyms	A2MR\|APOER\|APR\|CD91\|IGFBP3R\|LRP\|LRP1A\|TGFBR5
Description	LDL receptor related protein 1
Reference	MIM:107770\|HGNC:HGNC:6692\|Ensembl:ENSG00000123384\|HPRD:00138\|Vega:OTTHUMG00000044412
Gene type	protein-coding
Map location	12q13.3
Pascal p-value	6.808E-4
Sherlock p-value	0.991
TADA p-value	0.008
Fetal beta	1.604
Support	CELL METABOLISM G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Girard_2011	Whole Exome Sequencing analysis	The data set included 15 DNMs found from the exomes of 14 schizophrenia probands and their parents.
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 1.7051

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
LRP1	chr12	57579450	C	A	NM_002332	p.2200Y>*	nonsense			Schizophrenia	DNM:Girard_2011

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
COL3A1	0.90	0.64
OLFML3	0.87	0.73
C7	0.86	0.73
BMP5	0.86	0.59
ASPN	0.85	0.74
OGN	0.82	0.78
PCOLCE	0.81	0.48
AL137026.3	0.81	0.54
SERPIND1	0.80	0.59
COL1A2	0.80	0.67

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.33	-0.25	-0.19
ACADVL	-0.24	-0.27
AF347015.26	-0.24	-0.19
S100A1	-0.24	-0.12
AF347015.8	-0.24	-0.19
MT-CO2	-0.24	-0.18
AF347015.2	-0.24	-0.20
AF347015.27	-0.24	-0.17
AF347015.15	-0.23	-0.17
AC018755.7	-0.23	-0.15

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	TAS		10880251
GO:0005509	calcium ion binding	IEA		-
GO:0005509	calcium ion binding	TAS		3266596
GO:0005319	lipid transporter activity	TAS		3266596
GO:0008034	lipoprotein binding	TAS		2779654
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008283	cell proliferation	TAS		3266596
GO:0006629	lipid metabolic process	TAS		3266596
GO:0006897	endocytosis	IEA		-
GO:0007275	multicellular organismal development	IEA		-
GO:0030178	negative regulation of Wnt receptor signaling pathway	IEA		-
GO:0043277	apoptotic cell clearance	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005624	membrane fraction	TAS		2779654
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0005905	coated pit	IEA		-
GO:0005886	plasma membrane	IEA		-
GO:0005887	integral to plasma membrane	TAS		3266596

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
A2M	CPAMD5 \| DKFZp779B086 \| FWP007 \| S863-7	alpha-2-macroglobulin	-	HPRD,BioGRID	10652313
ANAPC10	APC10 \| DKFZp564L0562 \| DOC1	anaphase promoting complex subunit 10	-	HPRD,BioGRID	10827173
APBA2	D15S1518E \| HsT16821 \| LIN-10 \| MGC99508 \| MGC:14091 \| MINT2 \| X11L	amyloid beta (A4) precursor protein-binding, family A, member 2	Two-hybrid	BioGRID	10827173
APBB1	FE65 \| MGC:9072 \| RIR	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)	-	HPRD,BioGRID	9837937
APOE	AD2 \| LPG \| MGC1571 \| apoprotein	apolipoprotein E	-	HPRD	11421580
APP	AAA \| ABETA \| ABPP \| AD1 \| APPI \| CTFgamma \| CVAP \| PN2	amyloid beta (A4) precursor protein	-	HPRD	7543026 \|12212791
C3	ARMD9 \| ASP \| CPAMD1	complement component 3	-	HPRD	10608878
C4BPA	C4BP \| PRP	complement component 4 binding protein, alpha	-	HPRD	11705989
CALCR	CRT \| CTR \| CTR1	calcitonin receptor	Affinity Capture-Western Reconstituted Complex	BioGRID	12821648
CALR	CRT \| FLJ26680 \| RO \| SSA \| cC1qR	calreticulin	-	HPRD,BioGRID	12821648 \|14980518
CANX	CNX \| FLJ26570 \| IP90 \| P90	calnexin	-	HPRD,BioGRID	14980518
CD82	4F9 \| C33 \| GR15 \| IA4 \| KAI1 \| R2 \| SAR2 \| ST6 \| TSPAN27	CD82 molecule	-	HPRD	9804823
CTGF	CCN2 \| HCS24 \| IGFBP8 \| MGC102839 \| NOV2	connective tissue growth factor	-	HPRD	14585398
CTSG	CG \| MGC23078	cathepsin G	LRP interacts with Cathepsin G.	BIND	15131125
DAB1	-	disabled homolog 1 (Drosophila)	-	HPRD,BioGRID	10827173
DAB2	DOC-2 \| DOC2 \| FLJ26626	disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)	Reconstituted Complex	BioGRID	11247302
DLG4	FLJ97752 \| FLJ98574 \| PSD95 \| SAP90	discs, large homolog 4 (Drosophila)	-	HPRD,BioGRID	10827173
ELA2	GE \| HLE \| HNE \| NE \| PMN-E	elastase 2, neutrophil	LRP interacts with Elastase 2.	BIND	15131125
F8	AHF \| DXS1253E \| F8B \| F8C \| FVIII \| HEMA	coagulation factor VIII, procoagulant component	-	HPRD,BioGRID	12522143
F9	FIX \| HEMB \| MGC129641 \| MGC129642 \| PTC	coagulation factor IX	-	HPRD,BioGRID	12522212
FURIN	FUR \| PACE \| PCSK3 \| SPC1	furin (paired basic amino acid cleaving enzyme)	-	HPRD	8546712
GIPC1	C19orf3 \| GIPC \| GLUT1CBP \| Hs.6454 \| IIP-1 \| MGC15889 \| MGC3774 \| NIP \| RGS19IP1 \| SEMCAP \| SYNECTIIN \| SYNECTIN \| TIP-2	GIPC PDZ domain containing family, member 1	Reconstituted Complex Two-hybrid	BioGRID	10827173
GTPBP1	GP-1 \| GP1 \| HSPC018 \| MGC20069	GTP binding protein 1	-	HPRD	9820815
GULP1	CED-6 \| CED6 \| FLJ31156 \| GULP	GULP, engulfment adaptor PTB domain containing 1	-	HPRD,BioGRID	11729193
HSP90B1	ECGP \| GP96 \| GRP94 \| TRA1	heat shock protein 90kDa beta (Grp94), member 1	-	HPRD	11861214
ITGB1BP1	DKFZp686K08158 \| ICAP-1A \| ICAP-1B \| ICAP-1alpha \| ICAP1 \| ICAP1A \| ICAP1B	integrin beta 1 binding protein 1	-	HPRD,BioGRID	10827173
KAT5	ESA1 \| HTATIP \| HTATIP1 \| PLIP \| TIP \| TIP60 \| cPLA2	K(lysine) acetyltransferase 5	-	HPRD,BioGRID	12888553
LIPC	HDLCQ12 \| HL \| HTGL \| LIPH	lipase, hepatic	-	HPRD,BioGRID	7721852
LPL	HDLCQ11 \| LIPD	lipoprotein lipase	-	HPRD	1281473\|7510694 \|7989348
LPL	HDLCQ11 \| LIPD	lipoprotein lipase	Reconstituted Complex	BioGRID	1281473 \|7510694 \|7989348
LRPAP1	A2MRAP \| A2RAP \| HBP44 \| MGC138272 \| MRAP \| RAP	low density lipoprotein receptor-related protein associated protein 1	-	HPRD,BioGRID	1374383 \|1718973 \|10747918
LTF	GIG12 \| HLF2 \| LF	lactotransferrin	-	HPRD	1464627
MAPK8IP1	IB1 \| JIP-1 \| JIP1 \| PRKM8IP	mitogen-activated protein kinase 8 interacting protein 1	-	HPRD,BioGRID	10827173
MAPK8IP2	IB2 \| JIP2 \| PRKM8IPL	mitogen-activated protein kinase 8 interacting protein 2	Reconstituted Complex Two-hybrid	BioGRID	10827173
MDK	FLJ27379 \| MK \| NEGF2	midkine (neurite growth-promoting factor 2)	-	HPRD,BioGRID	10772929
MMP13	CLG3	matrix metallopeptidase 13 (collagenase 3)	-	HPRD	10514495
MMP14	MMP-X1 \| MT1-MMP \| MTMMP1	matrix metallopeptidase 14 (membrane-inserted)	-	HPRD,BioGRID	14645246
MMP15	MT2-MMP \| MTMMP2 \| SMCP-2	matrix metallopeptidase 15 (membrane-inserted)	-	HPRD	14645246
MMP16	MMP-X2 \| MT-MMP2 \| MT-MMP3 \| MT3-MMP	matrix metallopeptidase 16 (membrane-inserted)	-	HPRD	14645246
MMP17	MT4-MMP	matrix metallopeptidase 17 (membrane-inserted)	-	HPRD	14645246
NOS1AP	6330408P19Rik \| CAPON \| MGC138500	nitric oxide synthase 1 (neuronal) adaptor protein	-	HPRD,BioGRID	10827173
PDGFB	FLJ12858 \| PDGF2 \| SIS \| SSV \| c-sis	platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)	-	HPRD,BioGRID	11854294
PDIA2	PDA2 \| PDI \| PDIP \| PDIR	protein disulfide isomerase family A, member 2	Affinity Capture-Western	BioGRID	14980518
PLAT	DKFZp686I03148 \| T-PA \| TPA	plasminogen activator, tissue	-	HPRD,BioGRID	1502153 \|10632583
PLAUR	CD87 \| UPAR \| URKR	plasminogen activator, urokinase receptor	-	HPRD,BioGRID	11359936
SCN3A	KIAA1356 \| NAC3 \| Nav1.3	sodium channel, voltage-gated, type III, alpha subunit	Two-hybrid	BioGRID	10827173
SERPINA1	A1A \| A1AT \| AAT \| MGC23330 \| MGC9222 \| PI \| PI1 \| PRO2275	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1	LRP interacts with alpha-1-PI.	BIND	15131125
SERPINA3	AACT \| ACT \| GIG24 \| GIG25 \| MGC88254	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	LRP interacts with alpha-1-ACT.	BIND	15131125
SERPINE1	PAI \| PAI-1 \| PAI1 \| PLANH1	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	-	HPRD,BioGRID	15001579
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	Affinity Capture-Western Reconstituted Complex	BioGRID	11854294 \|12789267
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD	12069755 \|12789267
SNX17	KIAA0064	sorting nexin 17	Reconstituted Complex	BioGRID	12169628
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	Biochemical Activity	BioGRID	11854294
SYNJ2BP	ARIP2 \| FLJ11271 \| FLJ41973 \| OMP25	synaptojanin 2 binding protein	-	HPRD,BioGRID	10827173
THBS1	THBS \| TSP \| TSP1	thrombospondin 1	-	HPRD,BioGRID	9045712 \|14991768

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ALZHEIMERS DISEASE	169	110	All SZGR 2.0 genes in this pathway
ST WNT BETA CATENIN PATHWAY	34	28	All SZGR 2.0 genes in this pathway
PID AMB2 NEUTROPHILS PATHWAY	41	32	All SZGR 2.0 genes in this pathway
PID UPA UPAR PATHWAY	42	30	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP	567	375	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
JOHANSSON BRAIN CANCER EARLY VS LATE DN	45	35	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
NADLER OBESITY UP	61	34	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN	366	238	All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA DN	408	274	All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER HEREDITARY VS SPORADIC	50	32	All SZGR 2.0 genes in this pathway
CHANG IMMORTALIZED BY HPV31 DN	65	45	All SZGR 2.0 genes in this pathway
JIANG VHL TARGETS	138	91	All SZGR 2.0 genes in this pathway
VERRECCHIA RESPONSE TO TGFB1 C2	25	18	All SZGR 2.0 genes in this pathway
VERRECCHIA EARLY RESPONSE TO TGFB1	58	43	All SZGR 2.0 genes in this pathway
KAYO CALORIE RESTRICTION MUSCLE UP	95	64	All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL	311	205	All SZGR 2.0 genes in this pathway
ABE INNER EAR	48	26	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY 4NQO OR UV	63	44	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP	226	164	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER ERBB2 UP	147	83	All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS	425	261	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP	260	174	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP	245	159	All SZGR 2.0 genes in this pathway
WINTER HYPOXIA METAGENE	242	168	All SZGR 2.0 genes in this pathway
HELLEBREKERS SILENCED DURING TUMOR ANGIOGENESIS	80	56	All SZGR 2.0 genes in this pathway
MIZUKAMI HYPOXIA DN	6	5	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR UP	293	203	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN	457	302	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
COULOUARN TEMPORAL TGFB1 SIGNATURE DN	138	99	All SZGR 2.0 genes in this pathway
SETLUR PROSTATE CANCER TMPRSS2 ERG FUSION UP	67	48	All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT DN	222	141	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3	718	401	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3	445	257	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP	430	288	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B	549	316	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE	317	190	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF	367	231	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	213	219	m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	213	219	m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-200bc/429	167	174	1A,m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-205	118	125	1A,m8	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-369-3p	169	175	m8	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-496	110	116	1A	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: LRP1