SZGR2

Summary ?

GeneID	4089
Symbol	SMAD4
Synonyms	DPC4\|JIP\|MADH4\|MYHRS
Description	SMAD family member 4
Reference	MIM:600993\|HGNC:HGNC:6770\|Ensembl:ENSG00000141646\|HPRD:02995\|Vega:OTTHUMG00000132696
Gene type	protein-coding
Map location	18q21.1
Pascal p-value	0.201
Sherlock p-value	0.119
Fetal beta	1.113
DMG	2 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	4
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	4
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0482

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg10315128	18	48556631	SMAD4		-0.021	0.35	DMG:Nishioka_2013
cg27644254	18	48556578	SMAD4	4.17E-8	-0.008	1.16E-5	DMG:Jaffe_2016
cg23885062	18	48556580	SMAD4	8.29E-8	-0.008	1.93E-5	DMG:Jaffe_2016
cg10315128	18	48556631	SMAD4	9.67E-8	-0.006	2.16E-5	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
GO:0016563	transcription activator activity	IEA		-
GO:0042803	protein homodimerization activity	IPI		8774881
GO:0043565	sequence-specific DNA binding	IDA		10823886
GO:0046332	SMAD binding	IPI		8774881
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001666	response to hypoxia	IMP		12411310
GO:0001658	ureteric bud branching	IEA		-
GO:0001702	gastrulation with mouth forming second	IEA		-
GO:0001822	kidney development	IEA		-
GO:0007183	SMAD protein complex assembly	IDA		10823886
GO:0006350	transcription	IEA		-
GO:0009952	anterior/posterior pattern formation	IEA		-
GO:0008285	negative regulation of cell proliferation	IEA		-
GO:0017015	regulation of transforming growth factor beta receptor signaling pathway	IMP		8774881
GO:0051098	regulation of binding	IEA		-
GO:0030509	BMP signaling pathway	EXP		15621726
GO:0032909	regulation of transforming growth factor-beta2 production	IMP		12411310
GO:0030308	negative regulation of cell growth	IDA		8774881
GO:0045892	negative regulation of transcription, DNA-dependent	IDA		8774881
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005829	cytosol	EXP		9311995
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IEA		-
GO:0005654	nucleoplasm	EXP		10549282 \|11121043
GO:0005667	transcription factor complex	IPI		12374795
GO:0005737	cytoplasm	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACVR1B	ACTRIB \| ACVRLK4 \| ALK4 \| SKR2	activin A receptor, type IB	-	HPRD	9892009
AKT1	AKT \| MGC99656 \| PKB \| PKB-ALPHA \| PRKBA \| RAC \| RAC-ALPHA	v-akt murine thymoma viral oncogene homolog 1	Affinity Capture-Western	BioGRID	16362038
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	-	HPRD,BioGRID	12226080
ATF2	CRE-BP1 \| CREB2 \| HB16 \| MGC111558 \| TREB7	activating transcription factor 2	-	HPRD,BioGRID	10085140
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	BRCA1 interacts with Smad4. This interaction was modeled on a demonstrated interaction between BRCA1 from human and Smad4 from an unspecified species.	BIND	15735739
BTRC	BETA-TRCP \| FBW1A \| FBXW1 \| FBXW1A \| FWD1 \| MGC4643 \| bTrCP \| bTrCP1 \| betaTrCP	beta-transducin repeat containing	-	HPRD,BioGRID	14988407
CAMK2G	CAMK \| CAMK-II \| CAMKG \| FLJ16043 \| MGC26678	calcium/calmodulin-dependent protein kinase II gamma	-	HPRD,BioGRID	11027280
CDKN1A	CAP20 \| CDKN1 \| CIP1 \| MDA-6 \| P21 \| SDI1 \| WAF1 \| p21CIP1	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	Smad4 binds the distal region of the p21Cip1 promoter.	BIND	15084259
CEBPA	C/EBP-alpha \| CEBP	CCAAT/enhancer binding protein (C/EBP), alpha	Reconstituted Complex	BioGRID	12524424
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	CEBPB (C/EBP-beta) interacts with SMAD4. This interaction was modeled on a demonstrated interaction between CEBPB and SMAD4, both from unspecified species.	BIND	12202226
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	-	HPRD,BioGRID	12524424
CEBPD	C/EBP-delta \| CELF \| CRP3 \| NF-IL6-beta	CCAAT/enhancer binding protein (C/EBP), delta	Affinity Capture-Western Reconstituted Complex	BioGRID	12524424
CITED1	MSG1	Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1	-	HPRD,BioGRID	9707553
COPS5	CSN5 \| JAB1 \| MGC3149 \| MOV-34 \| SGN5	COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)	-	HPRD,BioGRID	11818334
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	-	HPRD,BioGRID	12000714
DACH1	DACH \| FLJ10138	dachshund homolog 1 (Drosophila)	-	HPRD	14525983
DCP1A	FLJ21691 \| HSA275986 \| Nbla00360 \| SMAD4IP1 \| SMIF	DCP1 decapping enzyme homolog A (S. cerevisiae)	-	HPRD,BioGRID	11836524
DLX1	-	distal-less homeobox 1	-	HPRD,BioGRID	14671321
DVL1	DVL \| MGC54245	dishevelled, dsh homolog 1 (Drosophila)	Reconstituted Complex	BioGRID	12650946
ECSIT	SITPEC	ECSIT homolog (Drosophila)	-	HPRD	14633973
EID2	CRI2 \| EID-2 \| MGC20452	EP300 interacting inhibitor of differentiation 2	-	HPRD,BioGRID	14612439
EP300	KAT3B \| p300	E1A binding protein p300	Affinity Capture-Western	BioGRID	10887155
EP300	KAT3B \| p300	E1A binding protein p300	p300 interacts with Smad4 fragment. p300 interacting with full-length Smad4 could not be demonstrated in vitro. This interaction was modeled on a demonstrated interaction between p300 from an unspecified species and human Smad4 fragment.	BIND	9679056
ERBB2IP	ERBIN \| LAP2	erbb2 interacting protein	-	HPRD,BioGRID	12650946
EWSR1	EWS	Ewing sarcoma breakpoint region 1	Two-hybrid	BioGRID	16189514
FOXH1	FAST-1 \| FAST1	forkhead box H1	Reconstituted Complex Two-hybrid	BioGRID	9288972
FOXO1	FKH1 \| FKHR \| FOXO1A	forkhead box O1	FoxO1 interacts with Smad4.	BIND	15084259
FOXO1	FKH1 \| FKHR \| FOXO1A	forkhead box O1	-	HPRD,BioGRID	15084259
FOXO3	AF6q21 \| DKFZp781A0677 \| FKHRL1 \| FKHRL1P2 \| FOXO2 \| FOXO3A \| MGC12739 \| MGC31925	forkhead box O3	-	HPRD,BioGRID	15084259
FOXO3	AF6q21 \| DKFZp781A0677 \| FKHRL1 \| FKHRL1P2 \| FOXO2 \| FOXO3A \| MGC12739 \| MGC31925	forkhead box O3	FoxO3 interacts with Smad4.	BIND	15084259
FOXO4	AFX \| AFX1 \| MGC120490 \| MLLT7	forkhead box O4	-	HPRD,BioGRID	15084259
FOXO4	AFX \| AFX1 \| MGC120490 \| MLLT7	forkhead box O4	FoxO4 interacts with Smad4.	BIND	15084259
FSTL3	FLRG \| FSRP	follistatin-like 3 (secreted glycoprotein)	-	HPRD	11571638
GLI3	ACLS \| GCPS \| PAP-A \| PAPA \| PAPA1 \| PAPB \| PHS \| PPDIV	GLI-Kruppel family member GLI3	-	HPRD	9843199
HOXA9	ABD-B \| HOX1 \| HOX1.7 \| HOX1G \| MGC1934	homeobox A9	-	HPRD,BioGRID	11042172
HOXC8	HOX3 \| HOX3A	homeobox C8	-	HPRD,BioGRID	10224145
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	-	HPRD	10220381
JUNB	AP-1	jun B proto-oncogene	-	HPRD,BioGRID	10220381
JUND	AP-1	jun D proto-oncogene	-	HPRD	10220381
KPNB1	IMB1 \| IPOB \| Impnb \| MGC2155 \| MGC2156 \| MGC2157 \| NTF97	karyopherin (importin) beta 1	Affinity Capture-Western	BioGRID	10846168
LEF1	DKFZp586H0919 \| TCF1ALPHA	lymphoid enhancer-binding factor 1	-	HPRD,BioGRID	10890911
MAX	MGC10775 \| MGC11225 \| MGC18164 \| MGC34679 \| MGC36767 \| bHLHd4 \| orf1	MYC associated factor X	-	HPRD,BioGRID	12551947
MDM4	DKFZp781B1423 \| HDMX \| MDMX \| MGC132766 \| MRP1	Mdm4 p53 binding protein homolog (mouse)	Reconstituted Complex	BioGRID	12483531
MED15	ARC105 \| CAG7A \| CTG7A \| DKFZp686A2214 \| DKFZp762B1216 \| FLJ42282 \| FLJ42935 \| PCQAP \| TIG-1 \| TIG1 \| TNRC7	mediator complex subunit 15	-	HPRD	12167862
MEF2A	ADCAD1 \| RSRFC4 \| RSRFC9	myocyte enhancer factor 2A	-	HPRD	11160896
PARD3B	ALS2CR19 \| MGC16131 \| PAR3B \| PAR3L \| PAR3LC \| PAR3beta \| Par3Lb	par-3 partitioning defective 3 homolog B (C. elegans)	Reconstituted Complex	BioGRID	12650946
PIAS3	FLJ14651 \| ZMIZ5	protein inhibitor of activated STAT, 3	-	HPRD,BioGRID	14691252
PIAS4	FLJ12419 \| MGC35296 \| PIASY \| Piasg \| ZMIZ6	protein inhibitor of activated STAT, 4	Affinity Capture-Western	BioGRID	12815042
RBL1	CP107 \| MGC40006 \| PRB1 \| p107	retinoblastoma-like 1 (p107)	-	HPRD,BioGRID	12150994
SKI	SKV	v-ski sarcoma viral oncogene homolog (avian)	-	HPRD,BioGRID	12419246 \|12857746
SKI	SKV	v-ski sarcoma viral oncogene homolog (avian)	Smad4 interacts with Ski. This interaction was modeled on a demonstrated interaction between human Smad4 and Ski from an unspecified species.	BIND	15761153
SKI	SKV	v-ski sarcoma viral oncogene homolog (avian)	c-Ski interacts with Smad4. This interaction was modelled on a demonstrated interaction between Smad4 from an unspecified source and human c-Ski.	BIND	10575014
SKIL	SNO \| SnoA \| SnoN	SKI-like oncogene	Smad4 interacts with SnoN. This interaction was modeled on a demonstrated interaction between human Smad4 and SnoN from an unspecified species.	BIND	15761153
SKIL	SNO \| SnoA \| SnoN	SKI-like oncogene	-	HPRD,BioGRID	10531062
SMAD1	BSP1 \| JV4-1 \| JV41 \| MADH1 \| MADR1	SMAD family member 1	-	HPRD	10400705 \|11700304
SMAD1	BSP1 \| JV4-1 \| JV41 \| MADH1 \| MADR1	SMAD family member 1	Affinity Capture-Western Co-fractionation	BioGRID	10531362 \|11700304 \|12874272
SMAD1	BSP1 \| JV4-1 \| JV41 \| MADH1 \| MADR1	SMAD family member 1	Smad4 interacts with Smad1.	BIND	15761153
SMAD2	JV18 \| JV18-1 \| MADH2 \| MADR2 \| MGC22139 \| MGC34440 \| hMAD-2 \| hSMAD2	SMAD family member 2	-	HPRD,BioGRID	11274206
SMAD2	JV18 \| JV18-1 \| MADH2 \| MADR2 \| MGC22139 \| MGC34440 \| hMAD-2 \| hSMAD2	SMAD family member 2	Smad4 interacts with Smad2.	BIND	15761153
SMAD2	JV18 \| JV18-1 \| MADH2 \| MADR2 \| MGC22139 \| MGC34440 \| hMAD-2 \| hSMAD2	SMAD family member 2	Smad2 interacts with Smad4. This interaction was modeled on a demonstrated interaction between Smad2 from an unspecified species and Smad4 from an unspecified species.	BIND	9311995
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	-	HPRD	9311995\|9732876
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	Smad3 interacts with Smad4. This interaction was modeled on a demonstrated interaction between Smad3 from an unspecified species and Smad4 from an unspecified species.	BIND	9311995
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	Smad4 interacts with Smad3.	BIND	15761153
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	Affinity Capture-Western	BioGRID	9311995 \|9892009 \|10531362 \|11114293 \|12419246 \|12794086 \|15084259
SMAD5	DKFZp781C1895 \| DKFZp781O1323 \| Dwfc \| JV5-1 \| MADH5	SMAD family member 5	Affinity Capture-Western	BioGRID	10531362
SMAD7	CRCS3 \| FLJ16482 \| MADH7 \| MADH8	SMAD family member 7	Phenotypic Suppression	BioGRID	9892009
SMAD9	MADH6 \| MADH9 \| SMAD8A \| SMAD8B	SMAD family member 9	Affinity Capture-Western Two-hybrid	BioGRID	10583507 \|16189514
SNIP1	FLJ12553 \| RP3-423B22.3 \| dJ423B22.2	Smad nuclear interacting protein 1	-	HPRD,BioGRID	10887155
SNW1	Bx42 \| MGC119379 \| NCOA-62 \| PRPF45 \| Prp45 \| SKIIP \| SKIP	SNW domain containing 1	Phenotypic Enhancement Two-hybrid	BioGRID	11278756
SP1	-	Sp1 transcription factor	-	HPRD	11432852
SPTBN1	ELF \| SPTB2 \| betaSpII	spectrin, beta, non-erythrocytic 1	-	HPRD	12543979
STK11IP	KIAA1898 \| LIP1 \| LKB1IP \| STK11IP1	serine/threonine kinase 11 interacting protein	-	HPRD,BioGRID	11741830
STUB1	CHIP \| HSPABP2 \| NY-CO-7 \| SDCCAG7 \| UBOX1	STIP1 homology and U-box containing protein 1	Smad4 interacts with CHIP. This interaction was modeled on a demonstrated interaction between Smad1 and CHIP, both from an unspecified species.	BIND	15708501
SUMO1	DAP-1 \| GMP1 \| OFC10 \| PIC1 \| SENP2 \| SMT3 \| SMT3C \| SMT3H3 \| SUMO-1 \| UBL1	SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)	SMAD4 is sumoylated.	BIND	15592428
TFE3	RCCP2 \| TFEA \| bHLHe33	transcription factor binding to IGHM enhancer 3	-	HPRD,BioGRID	10557285
TGFB1I1	ARA55 \| HIC-5 \| HIC5 \| TSC-5	transforming growth factor beta 1 induced transcript 1	ARA55 interacts with Smad4. This interaction was modeled on a demonstrated interaction between human ARA55 and Smad4 from an unspecified species.	BIND	15561701
TGFBR1	AAT5 \| ACVRLK4 \| ALK-5 \| ALK5 \| LDS1A \| LDS2A \| SKR4 \| TGFR-1	transforming growth factor, beta receptor 1	T-beta-RI phosphorylates hMAD-4. This interaction was modeled on a demonstrated interaction between T-beta-RI from an unspecified species and human hMAD-4.	BIND	8774881
TGFBR1	AAT5 \| ACVRLK4 \| ALK-5 \| ALK5 \| LDS1A \| LDS2A \| SKR4 \| TGFR-1	transforming growth factor, beta receptor 1	Co-fractionation	BioGRID	11102446
TGFBR2	AAT3 \| FAA3 \| LDS1B \| LDS2B \| MFS2 \| RIIC \| TAAD2 \| TGFR-2 \| TGFbeta-RII	transforming growth factor, beta receptor II (70/80kDa)	T-beta-RII phosphorylates hMAD-4. This interaction was modeled on a demonstrated interaction between T-beta-RII from an unspecified species and human hMAD-4.	BIND	8774881
TGFBRAP1	TRAP-1 \| TRAP1	transforming growth factor, beta receptor associated protein 1	-	HPRD,BioGRID	11278302
TOB1	APRO6 \| MGC104792 \| MGC34446 \| PIG49 \| TOB \| TROB \| TROB1	transducer of ERBB2, 1	-	HPRD,BioGRID	11163184
TRIM33	FLJ32925 \| PTC7 \| RFG7 \| TF1G \| TIF1G \| TIF1GAMMA \| TIFGAMMA	tripartite motif-containing 33	Smad4 interacts with Ecto.	BIND	15820681
TSSK3	SPOGA3 \| STK22C \| STK22D	testis-specific serine kinase 3	SMAD4 interacts with STK22C. This interaction was modeled on a demonstrated interaction between human SMAD4 and mouse STK22C.	BIND	15761153
UBE2I	C358B7.1 \| P18 \| UBC9	ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	Two-hybrid	BioGRID	16189514
UBE2L3	E2-F1 \| L-UBC \| UBCH7 \| UbcM4	ubiquitin-conjugating enzyme E2L 3	-	HPRD	12794086
ZNF423	Ebfaz \| KIAA0760 \| MGC138520 \| MGC138522 \| OAZ \| Roaz \| ZFP423 \| Zfp104	zinc finger protein 423	-	HPRD,BioGRID	10660046
ZNF521	DKFZp564D0764 \| EHZF \| Evi3 \| MGC142182 \| MGC142208	zinc finger protein 521	-	HPRD	14630787
ZNF8	HF.18 \| Zfp128	zinc finger protein 8	-	HPRD	12370310

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CELL CYCLE	128	84	All SZGR 2.0 genes in this pathway
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
KEGG TGF BETA SIGNALING PATHWAY	86	64	All SZGR 2.0 genes in this pathway
KEGG ADHERENS JUNCTION	75	53	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG COLORECTAL CANCER	62	47	All SZGR 2.0 genes in this pathway
KEGG PANCREATIC CANCER	70	56	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
BIOCARTA ALK PATHWAY	37	29	All SZGR 2.0 genes in this pathway
BIOCARTA G1 PATHWAY	28	21	All SZGR 2.0 genes in this pathway
BIOCARTA CTCF PATHWAY	23	18	All SZGR 2.0 genes in this pathway
BIOCARTA NTHI PATHWAY	24	20	All SZGR 2.0 genes in this pathway
BIOCARTA TOB1 PATHWAY	21	14	All SZGR 2.0 genes in this pathway
BIOCARTA TGFB PATHWAY	19	14	All SZGR 2.0 genes in this pathway
BIOCARTA WNT PATHWAY	26	24	All SZGR 2.0 genes in this pathway
PID SMAD2 3NUCLEAR PATHWAY	82	63	All SZGR 2.0 genes in this pathway
PID MYC ACTIV PATHWAY	79	62	All SZGR 2.0 genes in this pathway
PID LKB1 PATHWAY	47	37	All SZGR 2.0 genes in this pathway
PID BMP PATHWAY	42	31	All SZGR 2.0 genes in this pathway
PID ALK1 PATHWAY	26	21	All SZGR 2.0 genes in this pathway
PID ERA GENOMIC PATHWAY	65	37	All SZGR 2.0 genes in this pathway
PID ALK2 PATHWAY	11	9	All SZGR 2.0 genes in this pathway
PID SMAD2 3PATHWAY	17	13	All SZGR 2.0 genes in this pathway
PID MYC REPRESS PATHWAY	63	52	All SZGR 2.0 genes in this pathway
PID HIF1 TFPATHWAY	66	52	All SZGR 2.0 genes in this pathway
PID TGFBR PATHWAY	55	38	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NODAL	18	11	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY BMP	23	15	All SZGR 2.0 genes in this pathway
REACTOME SMAD2 SMAD3 SMAD4 HETEROTRIMER REGULATES TRANSCRIPTION	27	17	All SZGR 2.0 genes in this pathway
REACTOME TGF BETA RECEPTOR SIGNALING ACTIVATES SMADS	26	16	All SZGR 2.0 genes in this pathway
REACTOME TRANSCRIPTIONAL ACTIVITY OF SMAD2 SMAD3 SMAD4 HETEROTRIMER	38	26	All SZGR 2.0 genes in this pathway
REACTOME DOWNREGULATION OF SMAD2 3 SMAD4 TRANSCRIPTIONAL ACTIVITY	20	14	All SZGR 2.0 genes in this pathway
REACTOME GENERIC TRANSCRIPTION PATHWAY	352	181	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY TGF BETA RECEPTOR COMPLEX	63	42	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE DN	244	147	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA UP	305	185	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP	431	237	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR DN	129	84	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN	537	339	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 48HR UP	128	95	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 96HR UP	117	84	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 XPCS DN	88	71	All SZGR 2.0 genes in this pathway
TURJANSKI MAPK1 AND MAPK2 TARGETS	12	10	All SZGR 2.0 genes in this pathway
BREUHAHN GROWTH FACTOR SIGNALING IN LIVER CANCER	22	19	All SZGR 2.0 genes in this pathway
HUMMERICH SKIN CANCER PROGRESSION DN	100	64	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER DN	203	134	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
WEI MIR34A TARGETS	148	97	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
DER IFN ALPHA RESPONSE UP	74	48	All SZGR 2.0 genes in this pathway
DER IFN BETA RESPONSE UP	102	67	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN	546	351	All SZGR 2.0 genes in this pathway
MA MYELOID DIFFERENTIATION DN	44	30	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER BRCA1 VS BRCA2	163	113	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA RADIATION	81	59	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP	226	164	All SZGR 2.0 genes in this pathway
STEARMAN LUNG CANCER EARLY VS LATE UP	125	89	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
GU PDEF TARGETS UP	71	49	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-146	390	397	1A,m8	hsa-miR-146a	UGAGAACUGAAUUCCAUGGGUU
miR-146	390	397	1A,m8	hsa-miR-146b^brain	UGAGAACUGAAUUCCAUAGGCU
miR-224	1194	1200	m8	hsa-miR-224	CAAGUCACUAGUGGUUCCGUUUA
miR-224	1194	1200	m8	hsa-miR-224	CAAGUCACUAGUGGUUCCGUUUA
miR-26	1034	1040	m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	1034	1040	m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-346	146	152	1A	hsa-miR-346^brain	UGUCUGCCCGCAUGCCUGCCUCU
miR-376c	966	972	m8	hsa-miR-376c	AACAUAGAGGAAAUUCCACG
miR-431	1121	1127	m8	hsa-miR-431	UGUCUUGCAGGCCGUCAUGCA
miR-544	982	988	m8	hsa-miR-544	AUUCUGCAUUUUUAGCAAGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SMAD4