Gene Page: MEF2C
Summary ?
GeneID | 4208 |
Symbol | MEF2C |
Synonyms | C5DELq14.3|DEL5q14.3 |
Description | myocyte enhancer factor 2C |
Reference | MIM:600662|HGNC:HGNC:6996|Ensembl:ENSG00000081189|HPRD:02809|Vega:OTTHUMG00000162634 |
Gene type | protein-coding |
Map location | 5q14.3 |
Pascal p-value | 0.001 |
Sherlock p-value | 0.398 |
Fetal beta | -0.27 |
DMG | 1 (# studies) |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg19734870 | 5 | 87956883 | MEF2C | 2.32E-9 | -0.013 | 1.76E-6 | DMG:Jaffe_2016 |
cg25611476 | 5 | 88179989 | MEF2C | 4.06E-9 | -0.014 | 2.49E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TRHDE | 0.70 | 0.79 |
NCAM2 | 0.68 | 0.75 |
GABRB2 | 0.68 | 0.74 |
HOMER1 | 0.68 | 0.67 |
EXPH5 | 0.67 | 0.69 |
RYR2 | 0.67 | 0.75 |
AP000751.3 | 0.67 | 0.62 |
SLC4A10 | 0.67 | 0.74 |
HTR2A | 0.67 | 0.74 |
CNKSR2 | 0.67 | 0.69 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
GSTM2 | -0.37 | -0.47 |
AC135586.1 | -0.33 | -0.42 |
EFEMP2 | -0.33 | -0.23 |
RFXANK | -0.32 | -0.38 |
NT5C | -0.31 | -0.33 |
BCL7C | -0.31 | -0.51 |
RAB13 | -0.31 | -0.42 |
FAM181B | -0.30 | -0.47 |
PECI | -0.29 | -0.33 |
RAB34 | -0.29 | -0.23 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | NAS | 8575763 | |
GO:0003702 | RNA polymerase II transcription factor activity | TAS | 8455629 | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 8455629 |
GO:0001568 | blood vessel development | IEA | - | |
GO:0001649 | osteoblast differentiation | IEA | - | |
GO:0002062 | chondrocyte differentiation | IEA | - | |
GO:0001958 | endochondral ossification | IEA | - | |
GO:0001974 | blood vessel remodeling | IEA | - | |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0007517 | muscle development | TAS | 8455629 | |
GO:0007507 | heart development | IEA | - | |
GO:0045941 | positive regulation of transcription | IEA | - | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
EP300 | KAT3B | p300 | E1A binding protein p300 | Phenotypic Enhancement Reconstituted Complex | BioGRID | 9001254 |
HDAC4 | HA6116 | HD4 | HDAC-A | HDACA | KIAA0288 | histone deacetylase 4 | - | HPRD | 10523670 |11504882 |
HDAC4 | HA6116 | HD4 | HDAC-A | HDACA | KIAA0288 | histone deacetylase 4 | Affinity Capture-Western Reconstituted Complex | BioGRID | 10523670 |11486037 |
MAPK14 | CSBP1 | CSBP2 | CSPB1 | EXIP | Mxi2 | PRKM14 | PRKM15 | RK | SAPK2A | p38 | p38ALPHA | mitogen-activated protein kinase 14 | - | HPRD | 9753748 |10330143 |
MAPK7 | BMK1 | ERK4 | ERK5 | PRKM7 | mitogen-activated protein kinase 7 | - | HPRD,BioGRID | 9753748 |
MAPK7 | BMK1 | ERK4 | ERK5 | PRKM7 | mitogen-activated protein kinase 7 | An unspecified isoform of ERK5 phosphorylates MEF2C. This interaction was modeled on a demonstrated interaction between ERK5 from an unspecified species and MEF2C from an unspecified species. | BIND | 12659851 |
MEF2D | DKFZp686I1536 | myocyte enhancer factor 2D | - | HPRD | 9858528 |
MYOD1 | MYF3 | MYOD | PUM | bHLHc1 | myogenic differentiation 1 | Two-hybrid | BioGRID | 9418854 |
MYOG | MYF4 | MYOGENIN | bHLHc3 | myogenin (myogenic factor 4) | Reconstituted Complex | BioGRID | 8548800 |
SMAD2 | JV18 | JV18-1 | MADH2 | MADR2 | MGC22139 | MGC34440 | hMAD-2 | hSMAD2 | SMAD family member 2 | - | HPRD,BioGRID | 11160896 |
SOX18 | HLTS | SRY (sex determining region Y)-box 18 | SOX18 directly interacts with MEF2C. This interaction is modeled on a demonstrated interaction between murine proteins. | BIND | 11554755 |
SOX18 | HLTS | SRY (sex determining region Y)-box 18 | - | HPRD,BioGRID | 11554755 |
SP1 | - | Sp1 transcription factor | - | HPRD,BioGRID | 9748305 |
TEAD1 | AA | REF1 | TCF13 | TEF-1 | TEA domain family member 1 (SV40 transcriptional enhancer factor) | Affinity Capture-Western Reconstituted Complex | BioGRID | 12061776 |
TWIST2 | DERMO1 | MGC117334 | bHLHa39 | twist homolog 2 (Drosophila) | - | HPRD,BioGRID | 11809751 |
VGLL2 | VGL2 | VITO1 | vestigial like 2 (Drosophila) | - | HPRD | 12376544 |
VGLL4 | KIAA0121 | VGL-4 | vestigial like 4 (Drosophila) | - | HPRD | 15140898 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
BIOCARTA ALK PATHWAY | 37 | 29 | All SZGR 2.0 genes in this pathway |
BIOCARTA AT1R PATHWAY | 36 | 28 | All SZGR 2.0 genes in this pathway |
BIOCARTA CARM ER PATHWAY | 35 | 27 | All SZGR 2.0 genes in this pathway |
BIOCARTA HDAC PATHWAY | 32 | 25 | All SZGR 2.0 genes in this pathway |
BIOCARTA MAPK PATHWAY | 87 | 68 | All SZGR 2.0 genes in this pathway |
BIOCARTA NFAT PATHWAY | 56 | 45 | All SZGR 2.0 genes in this pathway |
BIOCARTA P38MAPK PATHWAY | 40 | 31 | All SZGR 2.0 genes in this pathway |
BIOCARTA PGC1A PATHWAY | 26 | 20 | All SZGR 2.0 genes in this pathway |
BIOCARTA ERK5 PATHWAY | 18 | 15 | All SZGR 2.0 genes in this pathway |
PID SMAD2 3NUCLEAR PATHWAY | 82 | 63 | All SZGR 2.0 genes in this pathway |
PID HDAC CLASSII PATHWAY | 34 | 27 | All SZGR 2.0 genes in this pathway |
PID ERBB1 DOWNSTREAM PATHWAY | 105 | 78 | All SZGR 2.0 genes in this pathway |
PID P38 ALPHA BETA DOWNSTREAM PATHWAY | 38 | 29 | All SZGR 2.0 genes in this pathway |
PID MAPK TRK PATHWAY | 34 | 31 | All SZGR 2.0 genes in this pathway |
PID RB 1PATHWAY | 65 | 46 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME TRIF MEDIATED TLR3 SIGNALING | 74 | 54 | All SZGR 2.0 genes in this pathway |
REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE | 137 | 105 | All SZGR 2.0 genes in this pathway |
REACTOME NUCLEAR EVENTS KINASE AND TRANSCRIPTION FACTOR ACTIVATION | 24 | 20 | All SZGR 2.0 genes in this pathway |
REACTOME ERK MAPK TARGETS | 21 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME MYOGENESIS | 28 | 20 | All SZGR 2.0 genes in this pathway |
REACTOME MAP KINASE ACTIVATION IN TLR CASCADE | 50 | 37 | All SZGR 2.0 genes in this pathway |
REACTOME MAPK TARGETS NUCLEAR EVENTS MEDIATED BY MAP KINASES | 30 | 24 | All SZGR 2.0 genes in this pathway |
REACTOME CIRCADIAN CLOCK | 53 | 40 | All SZGR 2.0 genes in this pathway |
REACTOME TRAF6 MEDIATED INDUCTION OF NFKB AND MAP KINASES UPON TLR7 8 OR 9 ACTIVATION | 77 | 57 | All SZGR 2.0 genes in this pathway |
REACTOME NFKB AND MAP KINASES ACTIVATION MEDIATED BY TLR4 SIGNALING REPERTOIRE | 72 | 53 | All SZGR 2.0 genes in this pathway |
REACTOME MYD88 MAL CASCADE INITIATED ON PLASMA MEMBRANE | 83 | 63 | All SZGR 2.0 genes in this pathway |
REACTOME INNATE IMMUNE SYSTEM | 279 | 178 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATED TLR4 SIGNALLING | 93 | 69 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME TOLL RECEPTOR CASCADES | 118 | 84 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP | 351 | 230 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
HUTTMANN B CLL POOR SURVIVAL DN | 60 | 39 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D UP | 157 | 91 | All SZGR 2.0 genes in this pathway |
AKL HTLV1 INFECTION DN | 68 | 41 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION GRANULOCYTE UP | 55 | 34 | All SZGR 2.0 genes in this pathway |
LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 5 6WK DN | 137 | 97 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 6 7WK UP | 197 | 135 | All SZGR 2.0 genes in this pathway |
DUNNE TARGETS OF AML1 MTG8 FUSION DN | 19 | 17 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL TGFB1 TARGETS UP | 169 | 127 | All SZGR 2.0 genes in this pathway |
DARWICHE SKIN TUMOR PROMOTER DN | 185 | 115 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK LOW DN | 165 | 107 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK HIGH DN | 180 | 110 | All SZGR 2.0 genes in this pathway |
DARWICHE SQUAMOUS CELL CARCINOMA DN | 181 | 107 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION APOBEC2 | 27 | 19 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION 6HR | 40 | 23 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
TURJANSKI MAPK7 TARGETS | 8 | 8 | All SZGR 2.0 genes in this pathway |
TURJANSKI MAPK11 TARGETS | 5 | 5 | All SZGR 2.0 genes in this pathway |
TURJANSKI MAPK14 TARGETS | 10 | 10 | All SZGR 2.0 genes in this pathway |
EBAUER MYOGENIC TARGETS OF PAX3 FOXO1 FUSION | 50 | 26 | All SZGR 2.0 genes in this pathway |
AMUNDSON GENOTOXIC SIGNATURE | 105 | 68 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
MORI SMALL PRE BII LYMPHOCYTE DN | 76 | 52 | All SZGR 2.0 genes in this pathway |
MORI MATURE B LYMPHOCYTE UP | 90 | 62 | All SZGR 2.0 genes in this pathway |
CHESLER BRAIN HIGHEST GENETIC VARIANCE | 37 | 21 | All SZGR 2.0 genes in this pathway |
ROSS AML WITH MLL FUSIONS | 78 | 45 | All SZGR 2.0 genes in this pathway |
SHIPP DLBCL VS FOLLICULAR LYMPHOMA DN | 45 | 28 | All SZGR 2.0 genes in this pathway |
IIZUKA LIVER CANCER EARLY RECURRENCE | 11 | 10 | All SZGR 2.0 genes in this pathway |
ADDYA ERYTHROID DIFFERENTIATION BY HEMIN | 73 | 47 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
PARK HSC AND MULTIPOTENT PROGENITORS | 50 | 33 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP | 131 | 87 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED DN | 246 | 180 | All SZGR 2.0 genes in this pathway |
BASSO CD40 SIGNALING UP | 101 | 76 | All SZGR 2.0 genes in this pathway |
KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
MCCLUNG DELTA FOSB TARGETS 2WK | 48 | 36 | All SZGR 2.0 genes in this pathway |
EHRLICH ICF SYNDROM DN | 15 | 13 | All SZGR 2.0 genes in this pathway |
MCCLUNG CREB1 TARGETS UP | 100 | 72 | All SZGR 2.0 genes in this pathway |
WELCSH BRCA1 TARGETS UP | 198 | 132 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
TSENG IRS1 TARGETS UP | 113 | 71 | All SZGR 2.0 genes in this pathway |
NIKOLSKY OVERCONNECTED IN BREAST CANCER | 22 | 19 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION | 88 | 65 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
TOOKER GEMCITABINE RESISTANCE UP | 79 | 40 | All SZGR 2.0 genes in this pathway |
PARK APL PATHOGENESIS UP | 14 | 11 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 DN | 315 | 201 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF DN | 235 | 144 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
HOFFMANN SMALL PRE BII TO IMMATURE B LYMPHOCYTE UP | 70 | 49 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 60HR UP | 293 | 203 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 1 | 28 | 19 | All SZGR 2.0 genes in this pathway |
WOO LIVER CANCER RECURRENCE UP | 105 | 75 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 9 11 TRANSLOCATION | 130 | 87 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN | 321 | 200 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP | 570 | 339 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 36HR | 29 | 23 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
BOSCO ALLERGEN INDUCED TH2 ASSOCIATED MODULE | 151 | 86 | All SZGR 2.0 genes in this pathway |
GENTLES LEUKEMIC STEM CELL UP | 29 | 15 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-135 | 857 | 863 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-153 | 398 | 404 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-182 | 355 | 362 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-183 | 1875 | 1882 | 1A,m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-188 | 1842 | 1848 | m8 | hsa-miR-188 | CAUCCCUUGCAUGGUGGAGGGU |
miR-19 | 1080 | 1086 | 1A | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-194 | 287 | 293 | 1A | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
miR-203.1 | 1331 | 1337 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
hsa-miR-203 | UGAAAUGUUUAGGACCACUAG | ||||
miR-223 | 1627 | 1633 | m8 | hsa-miR-223 | UGUCAGUUUGUCAAAUACCCC |
hsa-miR-223 | UGUCAGUUUGUCAAAUACCCC | ||||
miR-23 | 1945 | 1952 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-27 | 975 | 981 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-30-3p | 377 | 383 | m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
miR-323 | 1945 | 1951 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-329 | 1677 | 1683 | m8 | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
miR-330 | 875 | 881 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
miR-362 | 1158 | 1164 | 1A | hsa-miR-362 | AAUCCUUGGAACCUAGGUGUGAGU |
miR-376c | 1787 | 1793 | m8 | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
miR-381 | 836 | 842 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU | ||||
miR-410 | 942 | 948 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-448 | 79 | 85 | m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU | ||||
miR-493-5p | 677 | 683 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU | ||||
hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU | ||||
miR-496 | 330 | 337 | 1A,m8 | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-505 | 1663 | 1669 | 1A | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
miR-539 | 2091 | 2097 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
miR-93.hd/291-3p/294/295/302/372/373/520 | 200 | 206 | m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU | ||||
miR-96 | 356 | 362 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.