SZGR2

Summary ?

GeneID	4763
Symbol	NF1
Synonyms	NFNS\|VRNF\|WSS
Description	neurofibromin 1
Reference	MIM:613113\|HGNC:HGNC:7765\|Ensembl:ENSG00000196712\|HPRD:01203\|Vega:OTTHUMG00000132871
Gene type	protein-coding
Map location	17q11.2
Pascal p-value	0.48
Fetal beta	0.312
DMG	1 (# studies)
Support	STRUCTURAL PLASTICITY G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 12
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0086

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg07917842	17	29672644	NF1	1.1E-5	0.488	0.013	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CRIP2	0.88	0.88
HTRA2	0.87	0.86
PIK3R2	0.86	0.87
C19orf22	0.86	0.87
CHMP1A	0.85	0.84
UNC119	0.85	0.85
KLHL22	0.85	0.86
ADCK2	0.85	0.84
TBCB	0.85	0.83
TOR3A	0.84	0.86

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MT-CO2	-0.71	-0.73
AF347015.33	-0.70	-0.74
AF347015.8	-0.70	-0.74
AF347015.27	-0.70	-0.74
MT-CYB	-0.70	-0.74
AF347015.26	-0.68	-0.76
AF347015.31	-0.68	-0.71
AF347015.15	-0.67	-0.72
AF347015.2	-0.66	-0.72
AF347015.21	-0.63	-0.70

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003674	molecular_function	ND		-
GO:0005099	Ras GTPase activator activity	IDA		1568247 \|1570015
GO:0005096	GTPase activator activity	IEA		-
GO:0005515	protein binding	IPI		11356864
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007420	brain development	ISS	Brain (GO term level: 7)	-
GO:0007406	negative regulation of neuroblast proliferation	ISS	neurogenesis (GO term level: 10)	-
GO:0022011	myelination in the peripheral nervous system	ISS	neuron, axon, dendrite (GO term level: 14)	-
GO:0048715	negative regulation of oligodendrocyte differentiation	ISS	oligodendrocyte, Glial (GO term level: 12)	-
GO:0021897	forebrain astrocyte development	ISS	neuron, astrocyte, Brain, Glial (GO term level: 11)	-
GO:0048485	sympathetic nervous system development	ISS	neuron, Neurotransmitter (GO term level: 7)	-
GO:0045685	regulation of glial cell differentiation	ISS	Glial (GO term level: 10)	-
GO:0021510	spinal cord development	ISS	Brain (GO term level: 7)	-
GO:0048853	forebrain morphogenesis	ISS	Brain (GO term level: 9)	-
GO:0043525	positive regulation of neuron apoptosis	ISS	neuron (GO term level: 9)	-
GO:0001666	response to hypoxia	ISS		-
GO:0001656	metanephros development	ISS		-
GO:0001649	osteoblast differentiation	ISS		-
GO:0001889	liver development	ISS		-
GO:0001937	negative regulation of endothelial cell proliferation	IMP		17404841
GO:0001952	regulation of cell-matrix adhesion	ISS		-
GO:0042992	negative regulation of transcription factor import into nucleus	ISS		-
GO:0007265	Ras protein signal transduction	ISS		-
GO:0007165	signal transduction	IEA		-
GO:0008542	visual learning	ISS		-
GO:0008150	biological_process	ND		-
GO:0007507	heart development	ISS		-
GO:0007422	peripheral nervous system development	ISS		-
GO:0014065	phosphoinositide 3-kinase cascade	ISS		-
GO:0042060	wound healing	ISS		-
GO:0030036	actin cytoskeleton organization	ISS		-
GO:0051056	regulation of small GTPase mediated signal transduction	IEA		-
GO:0021987	cerebral cortex development	ISS		-
GO:0043473	pigmentation	ISS		-
GO:0030199	collagen fibril organization	ISS		-
GO:0032320	positive regulation of Ras GTPase activity	ISS		-
GO:0030336	negative regulation of cell migration	IMP		16648142
GO:0030325	adrenal gland development	ISS		-
GO:0043409	negative regulation of MAPKKK cascade	ISS		-
GO:0048745	smooth muscle development	ISS		-
GO:0043407	negative regulation of MAP kinase activity	ISS		-
GO:0045762	positive regulation of adenylate cyclase activity	ISS		-
GO:0045765	regulation of angiogenesis	IMP		17404841
GO:0045786	negative regulation of cell cycle	IEA		-
GO:0045124	regulation of bone resorption	ISS		-
GO:0043535	regulation of blood vessel endothelial cell migration	IMP		17404841
GO:0048593	camera-type eye morphogenesis	ISS		-
GO:0050890	cognition	IMP		17299016
GO:0048844	artery morphogenesis	ISS		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030425	dendrite	IDA	neuron, axon, dendrite (GO term level: 6)	1550670
GO:0030424	axon	IDA	neuron, axon, Neurotransmitter (GO term level: 6)	1550670
GO:0005575	cellular_component	ND		-
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	ISS		1550670
GO:0005737	cytoplasm	ISS		1550670

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
PID HNF3B PATHWAY	45	37	All SZGR 2.0 genes in this pathway
PID ATF2 PATHWAY	59	43	All SZGR 2.0 genes in this pathway
PID SYNDECAN 2 PATHWAY	33	27	All SZGR 2.0 genes in this pathway
PID RAS PATHWAY	30	22	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
SOTIRIOU BREAST CANCER GRADE 1 VS 3 DN	52	34	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP	332	228	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP	473	314	All SZGR 2.0 genes in this pathway
GAL LEUKEMIC STEM CELL UP	133	78	All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP	233	161	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL UP	95	64	All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS UP	135	82	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
BIDUS METASTASIS UP	214	134	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN	537	339	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G UP	238	135	All SZGR 2.0 genes in this pathway
RODRIGUES NTN1 AND DCC TARGETS	35	25	All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 12	11	8	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
COURTOIS SENESCENCE TRIGGERS	6	5	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
TCGA GLIOBLASTOMA COPY NUMBER DN	31	21	All SZGR 2.0 genes in this pathway
DING LUNG CANCER MUTATED SIGNIFICANTLY	26	22	All SZGR 2.0 genes in this pathway
DING LUNG CANCER MUTATED FREQUENTLY	12	10	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS	185	114	All SZGR 2.0 genes in this pathway
PEART HDAC PROLIFERATION CLUSTER DN	76	57	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD2 UP	45	32	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP	314	201	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY DN	145	88	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR UP	178	111	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5	482	296	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION	175	125	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER SURVIVAL UP	185	112	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12	317	177	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE DN	204	114	All SZGR 2.0 genes in this pathway
TCGA GLIOBLASTOMA MUTATED	8	8	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN	841	431	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-10	914	920	1A	hsa-miR-10a	UACCCUGUAGAUCCGAAUUUGUG
miR-10	914	920	1A	hsa-miR-10b	UACCCUGUAGAACCGAAUUUGU
miR-103/107	177	183	m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
				hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
				hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
				hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-128	1195	1202	1A,m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	1195	1202	1A,m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-137	650	656	1A	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-153	2974	2980	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-182	1733	1740	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-27	1196	1203	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	1196	1203	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-30-5p	1702	1709	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-369-3p	3119	3125	m8	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-370	3358	3365	1A,m8	hsa-miR-370^brain	GCCUGCUGGGGUGGAACCUGG
miR-378	267	274	1A,m8	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-381	3264	3270	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-448	2974	2980	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-485-5p	540	546	1A	hsa-miR-485-5p	AGAGGCUGGCCGUGAUGAAUUC
miR-486	659	665	1A	hsa-miR-486	UCCUGUACUGAGCUGCCCCGAG
miR-490	1435	1441	m8	hsa-miR-490	CAACCUGGAGGACUCCAUGCUG
miR-496	1645	1651	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-496	1645	1651	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-543	2969	2975	1A	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-96	1734	1740	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NF1