SZGR2

Summary ?

GeneID	5590
Symbol	PRKCZ
Synonyms	PKC-ZETA\|PKC2
Description	protein kinase C zeta
Reference	MIM:176982\|HGNC:HGNC:9412\|Ensembl:ENSG00000067606\|HPRD:01504\|Vega:OTTHUMG00000001238
Gene type	protein-coding
Map location	1p36.33-p36.2
Pascal p-value	0.002
Sherlock p-value	0.994
Fetal beta	1.517
DMG	1 (# studies)
eGene	Meta
Support	INTRACELLULAR SIGNAL TRANSDUCTION

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	7
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 1.9141

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg01974180	1	2084246	PRKCZ	2.66E-5	0.468	0.018	DMG:Wockner_2014
cg04347414	1	2084519	PRKCZ	7.42E-5	0.628	0.025	DMG:Wockner_2014
cg02393699	1	2106620	PRKCZ	1.142E-4	0.412	0.029	DMG:Wockner_2014
cg00300046	1	2084595	PRKCZ	1.387E-4	0.671	0.031	DMG:Wockner_2014
cg24445388	1	2084391	PRKCZ	1.412E-4	0.743	0.031	DMG:Wockner_2014
cg17426766	1	2046864	PRKCZ	4.131E-4	0.365	0.044	DMG:Wockner_2014
cg18269141	1	2063966	PRKCZ	5.803E-4	0.353	0.049	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0004700	atypical protein kinase C activity	TAS		8224878
GO:0005515	protein binding	IPI		11755531 \|12893243
GO:0005524	ATP binding	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0019992	diacylglycerol binding	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000226	microtubule cytoskeleton organization	IEA		-
GO:0006468	protein amino acid phosphorylation	TAS		10477520
GO:0007242	intracellular signaling cascade	IEA		-
GO:0006916	anti-apoptosis	TAS		10770953
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005923	tight junction	IEA	Brain (GO term level: 10)	-
GO:0005624	membrane fraction	TAS		7925449
GO:0005737	cytoplasm	TAS		7925449
GO:0005768	endosome	IEA		-
GO:0005938	cell cortex	IEA		-
GO:0005886	plasma membrane	TAS		7925449
GO:0045179	apical cortex	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ADAP1	CENTA1 \| GCS1L \| p42IP4	ArfGAP with dual PH domains 1	-	HPRD,BioGRID	12893243
ADCY5	AC5	adenylate cyclase 5	-	HPRD	8206971
AFAP1	AFAP \| AFAP-110 \| FLJ56849	actin filament associated protein 1	-	HPRD	12134071
AKT1	AKT \| MGC99656 \| PKB \| PKB-ALPHA \| PRKBA \| RAC \| RAC-ALPHA	v-akt murine thymoma viral oncogene homolog 1	-	HPRD,BioGRID	10085094
AKT3	DKFZp434N0250 \| PKB-GAMMA \| PKBG \| PRKBG \| RAC-PK-gamma \| RAC-gamma \| STK-2	v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)	-	HPRD,BioGRID	12162751
C1QBP	GC1QBP \| HABP1 \| SF2p32 \| gC1Q-R \| gC1qR \| p32	complement component 1, q subcomponent binding protein	-	HPRD,BioGRID	10831594
CDC42	CDC42Hs \| G25K	cell division cycle 42 (GTP binding protein, 25kDa)	-	HPRD	10733591
CSNK2B	CK2B \| CK2N \| CSK2B \| G5A \| MGC138222 \| MGC138224	casein kinase 2, beta polypeptide	-	HPRD,BioGRID	10764587
DAPK3	FLJ36473 \| ZIP \| ZIPK	death-associated protein kinase 3	Reconstituted Complex	BioGRID	12242277
ECT2	FLJ10461 \| MGC138291	epithelial cell transforming sequence 2 oncogene	Affinity Capture-Western	BioGRID	15254234
FADD	GIG3 \| MGC8528 \| MORT1	Fas (TNFRSF6)-associated via death domain	-	HPRD,BioGRID	11739185
FEZ1	-	fasciculation and elongation protein zeta 1 (zygin I)	-	HPRD,BioGRID	9971736
FEZ2	HUM3CL \| MGC117372	fasciculation and elongation protein zeta 2 (zygin II)	-	HPRD,BioGRID	14697253
GRB14	-	growth factor receptor-bound protein 14	-	HPRD,BioGRID	12242277
HABP4	IHABP4 \| Ki-1/57 \| MGC825 \| SERBP1L	hyaluronan binding protein 4	-	HPRD	14699138
HNRNPA1	HNRPA1 \| MGC102835	heterogeneous nuclear ribonucleoprotein A1	PKC-zeta phosphorylates and interacts with hnRNPA1. This interaction was modeled on a demonstrated interaction between PKC-zeta and hnRNPA1, both from unspecified species.	BIND	10383403
IRAK1	IRAK \| pelle	interleukin-1 receptor-associated kinase 1	-	HPRD,BioGRID	11937546
IRS4	IRS-4 \| PY160	insulin receptor substrate 4	-	HPRD	12774026
KRT10	CK10 \| K10 \| KPP	keratin 10	-	HPRD,BioGRID	11585925
MAP2K5	HsT17454 \| MAPKK5 \| MEK5 \| PRKMK5	mitogen-activated protein kinase kinase 5	-	HPRD,BioGRID	11158308
MBP	MGC99675	myelin basic protein	PKC-zeta phosphorylates and interacts with MBP. This interaction was modeled on a demonstrated interaction between PKC-zeta and MBP, both from unspecified species.	BIND	10383403
NCL	C23 \| FLJ45706	nucleolin	-	HPRD,BioGRID	9388266
NFATC2	KIAA0611 \| NFAT1 \| NFATP	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	-	HPRD,BioGRID	12021260
PARD3	ASIP \| Baz \| Bazooka \| FLJ21015 \| PAR3 \| PAR3alpha \| PARD3A \| SE2-5L16 \| SE2-5LT1 \| SE2-5T2	par-3 partitioning defective 3 homolog (C. elegans)	Affinity Capture-Western	BioGRID	12459187
PARD6A	PAR-6A \| PAR6 \| PAR6C \| PAR6alpha \| TAX40 \| TIP-40	par-6 partitioning defective 6 homolog alpha (C. elegans)	-	HPRD,BioGRID	11260256
PARD6G	FLJ45701 \| PAR-6G \| PAR6gamma	par-6 partitioning defective 6 homolog gamma (C. elegans)	-	HPRD,BioGRID	11260256
PAWR	PAR4 \| Par-4	PRKC, apoptosis, WT1, regulator	Par-4 interacts with PKC-zeta. This interaction was modelled on a demonstrated interaction between human Par-4 and rat PKC-zeta.	BIND	8797824
PAWR	PAR4 \| Par-4	PRKC, apoptosis, WT1, regulator	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	8797824
PDLIM7	LMP1	PDZ and LIM domain 7 (enigma)	-	HPRD	8940095
PDPK1	MGC20087 \| MGC35290 \| PDK1 \| PRO0461	3-phosphoinositide dependent protein kinase-1	PRKCZ (PKCZ) interacts with PDPK1 (PDK1). This interaction was modelled on a demonstrated interaction between human PRKCZ and rat PDPK1.	BIND	11781095
PDPK1	MGC20087 \| MGC35290 \| PDK1 \| PRO0461	3-phosphoinositide dependent protein kinase-1	An unspecified isoform of PDPK1 (PDK1) phosphorylates PRKCZ (PKC-zeta). This interaction was modeled on a demonstrated interaction between PDPK1 from an unspecified species and PRKCZ from an unspecified species.	BIND	12223477
PDPK1	MGC20087 \| MGC35290 \| PDK1 \| PRO0461	3-phosphoinositide dependent protein kinase-1	-	HPRD,BioGRID	9748166 \|10764742 \|11781095
PPP1R14A	CPI-17 \| CPI17 \| PPP1INL	protein phosphatase 1, regulatory (inhibitor) subunit 14A	-	HPRD	15003508
PPP3CA	CALN \| CALNA \| CALNA1 \| CCN1 \| CNA1 \| PPP2B	protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform	-	HPRD	12021260
PRKCSH	AGE-R2 \| G19P1 \| PCLD \| PLD1	protein kinase C substrate 80K-H	PRKCZ (PKCZ) interacts with PRKCSH (80K-H).	BIND	15707389
PRKCZ	PKC-ZETA \| PKC2	protein kinase C, zeta	PKC-zeta autophosphorylates.	BIND	15665819
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	-	HPRD,BioGRID	10620507
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	-	HPRD,BioGRID	11684013
RPS6KB1	PS6K \| S6K \| S6K1 \| STK14A \| p70(S6K)-alpha \| p70-S6K \| p70-alpha	ribosomal protein S6 kinase, 70kDa, polypeptide 1	Affinity Capture-Western	BioGRID	16931574
SQSTM1	A170 \| OSIL \| PDB3 \| ZIP3 \| p60 \| p62 \| p62B	sequestosome 1	zetaPKC interacts with p62. This interaction was modelled on a demonstrated interaction between rat zetaPKC and human p62.	BIND	12813044
SQSTM1	A170 \| OSIL \| PDB3 \| ZIP3 \| p60 \| p62 \| p62B	sequestosome 1	-	HPRD	9566925 \|10356400
SQSTM1	A170 \| OSIL \| PDB3 \| ZIP3 \| p60 \| p62 \| p62B	sequestosome 1	Affinity Capture-Western	BioGRID	10747026
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	-	HPRD,BioGRID	10527887
TIAM1	FLJ36302	T-cell lymphoma invasion and metastasis 1	Biochemical Activity	BioGRID	10212259
TRAF6	MGC:3310 \| RNF85	TNF receptor-associated factor 6	-	HPRD,BioGRID	10747026
WWC1	FLJ10865 \| FLJ23369 \| KIAA0869 \| KIBRA	WW and C2 domain containing 1	-	HPRD,BioGRID	15081397
YWHAB	GW128 \| HS1 \| KCIP-1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide	-	HPRD,BioGRID	10620507
YWHAG	14-3-3GAMMA	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide	Affinity Capture-Western	BioGRID	10620507
YWHAH	YWHA1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide	Affinity Capture-Western	BioGRID	10620507
YWHAQ	14-3-3 \| 1C5 \| HS1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide	Affinity Capture-Western Biochemical Activity Reconstituted Complex	BioGRID	10620507
YWHAZ	KCIP-1 \| MGC111427 \| MGC126532 \| MGC138156	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide	Biochemical Activity Reconstituted Complex	BioGRID	10620507 \|12893243

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CHEMOKINE SIGNALING PATHWAY	190	128	All SZGR 2.0 genes in this pathway
KEGG ENDOCYTOSIS	183	132	All SZGR 2.0 genes in this pathway
KEGG TIGHT JUNCTION	134	86	All SZGR 2.0 genes in this pathway
KEGG INSULIN SIGNALING PATHWAY	137	103	All SZGR 2.0 genes in this pathway
KEGG TYPE II DIABETES MELLITUS	47	41	All SZGR 2.0 genes in this pathway
BIOCARTA PTDINS PATHWAY	23	16	All SZGR 2.0 genes in this pathway
PID RHOA PATHWAY	45	33	All SZGR 2.0 genes in this pathway
PID INSULIN PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID WNT NONCANONICAL PATHWAY	32	26	All SZGR 2.0 genes in this pathway
PID MET PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID CDC42 PATHWAY	70	51	All SZGR 2.0 genes in this pathway
PID TXA2PATHWAY	57	43	All SZGR 2.0 genes in this pathway
PID IL1 PATHWAY	34	28	All SZGR 2.0 genes in this pathway
PID NFAT 3PATHWAY	54	47	All SZGR 2.0 genes in this pathway
PID CXCR4 PATHWAY	102	78	All SZGR 2.0 genes in this pathway
PID IGF1 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID TNF PATHWAY	46	33	All SZGR 2.0 genes in this pathway
PID IL2 PI3K PATHWAY	34	27	All SZGR 2.0 genes in this pathway
PID CERAMIDE PATHWAY	48	37	All SZGR 2.0 genes in this pathway
PID P75 NTR PATHWAY	69	51	All SZGR 2.0 genes in this pathway
PID AMB2 NEUTROPHILS PATHWAY	41	32	All SZGR 2.0 genes in this pathway
PID ERBB1 DOWNSTREAM PATHWAY	105	78	All SZGR 2.0 genes in this pathway
PID TRKR PATHWAY	62	48	All SZGR 2.0 genes in this pathway
PID NEPHRIN NEPH1 PATHWAY	31	24	All SZGR 2.0 genes in this pathway
PID INSULIN GLUCOSE PATHWAY	26	24	All SZGR 2.0 genes in this pathway
PID RAS PATHWAY	30	22	All SZGR 2.0 genes in this pathway
REACTOME TGF BETA RECEPTOR SIGNALING IN EMT EPITHELIAL TO MESENCHYMAL TRANSITION	16	7	All SZGR 2.0 genes in this pathway
REACTOME GPVI MEDIATED ACTIVATION CASCADE	31	25	All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS	466	331	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY TGF BETA RECEPTOR COMPLEX	63	42	All SZGR 2.0 genes in this pathway
REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION	208	138	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
CHIN BREAST CANCER COPY NUMBER DN	16	10	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP	239	157	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
JOHANSSON GLIOMAGENESIS BY PDGFB DN	21	16	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
SCHEIDEREIT IKK INTERACTING PROTEINS	58	45	All SZGR 2.0 genes in this pathway
DACOSTA ERCC3 ALLELE XPCS VS TTD DN	36	27	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
JECHLINGER EPITHELIAL TO MESENCHYMAL TRANSITION DN	66	47	All SZGR 2.0 genes in this pathway
GOLDRATH IMMUNE MEMORY	65	42	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN	366	238	All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP	131	87	All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN	153	120	All SZGR 2.0 genes in this pathway
BHATI G2M ARREST BY 2METHOXYESTRADIOL DN	127	75	All SZGR 2.0 genes in this pathway
CUI GLUCOSE DEPRIVATION	60	44	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K27ME3	79	59	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3	341	243	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL DN	428	246	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-338	203	209	1A	hsa-miR-338^brain	UCCAGCAUCAGUGAUUUUGUUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PRKCZ