SZGR2

Summary ?

GeneID	5781
Symbol	PTPN11
Synonyms	BPTP3\|CFC\|JMML\|METCDS\|NS1\|PTP-1D\|PTP2C\|SH-PTP2\|SH-PTP3\|SHP2
Description	protein tyrosine phosphatase, non-receptor type 11
Reference	MIM:176876\|HGNC:HGNC:9644\|Ensembl:ENSG00000179295\|HPRD:01470\|Vega:OTTHUMG00000134334
Gene type	protein-coding
Map location	12q24
Pascal p-value	0.209
Sherlock p-value	7.809E-4
Fetal beta	-0.506
Support	G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.9666

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
OTUD7A	0.88	0.82
TACC1	0.87	0.82
ZMAT3	0.85	0.80
MBNL1	0.84	0.80
KIAA1671	0.83	0.79
CHIC1	0.83	0.80
RAPGEF5	0.83	0.73
NR3C1	0.82	0.77
FAM120A	0.82	0.82
MBNL2	0.82	0.78

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
EXOSC8	-0.47	-0.53
SNHG12	-0.47	-0.62
RPL27	-0.46	-0.56
C9orf46	-0.46	-0.54
ST20	-0.45	-0.54
RPL35	-0.45	-0.54
PFDN5	-0.44	-0.52
RPL31	-0.44	-0.55
RPS13P2	-0.44	-0.54
RPS23	-0.44	-0.55

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		9658397 \|9792637 \|10209036
GO:0004726	non-membrane spanning protein tyrosine phosphatase activity	EXP		10734310 \|14560030 \|14665621 \|15574420
GO:0004726	non-membrane spanning protein tyrosine phosphatase activity	TAS		7681589
GO:0016787	hydrolase activity	IEA		-
GO:0051428	peptide hormone receptor binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007409	axonogenesis	IEA	neuron, axon, neurite (GO term level: 12)	-
GO:0000077	DNA damage checkpoint	IEA		-
GO:0000187	activation of MAPK activity	IEA		-
GO:0009967	positive regulation of signal transduction	IEA		-
GO:0006470	protein amino acid dephosphorylation	IEA		-
GO:0009755	hormone-mediated signaling	IEA		-
GO:0007605	sensory perception of sound	IEA		-
GO:0048011	nerve growth factor receptor signaling pathway	IEA		-
GO:0006641	triacylglycerol metabolic process	IEA		-
GO:0006629	lipid metabolic process	IEA		-
GO:0042593	glucose homeostasis	IEA		-
GO:0042445	hormone metabolic process	IEA		-
GO:0035265	organ growth	IEA		-
GO:0040014	regulation of multicellular organism growth	IEA		-
GO:0046887	positive regulation of hormone secretion	IEA		-
GO:0046676	negative regulation of insulin secretion	IEA		-
GO:0046825	regulation of protein export from nucleus	IEA		-
GO:0048609	reproductive process in a multicellular organism	IEA		-
GO:0060125	negative regulation of growth hormone secretion	IEA		-
GO:0051463	negative regulation of cortisol secretion	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005829	cytosol	EXP		9054388 \|10734310 \|14560030 \|14665621 \|15574420
GO:0005737	cytoplasm	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BCAR1	CAS \| CAS1 \| CASS1 \| CRKAS \| P130Cas	breast cancer anti-estrogen resistance 1	Affinity Capture-Western	BioGRID	9188452
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	Phosphorylated p210bcr-abl interacts with phosphorylated Syp. This interaction was modeled on a demonstrated interaction between human p210bcr-abl and mouse Syp.	BIND	8195176
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	-	HPRD	12115002
BDKRB2	B2R \| BK-2 \| BK2 \| BKR2 \| BRB2 \| DKFZp686O088	bradykinin receptor B2	-	HPRD	12177051
BTLA	BTLA1 \| CD272 \| FLJ16065 \| MGC129743	B and T lymphocyte associated	-	HPRD,BioGRID	12796776
C6orf25	G6b \| MGC142279 \| MGC142281 \| NG31	chromosome 6 open reading frame 25	-	HPRD,BioGRID	11544253
CAT	MGC138422 \| MGC138424	catalase	Cat interacts with Shp-2.	BIND	15556604
CAV1	CAV \| MSTP085 \| VIP21	caveolin 1, caveolae protein, 22kDa	-	HPRD,BioGRID	12176037
CAV1	CAV \| MSTP085 \| VIP21	caveolin 1, caveolae protein, 22kDa	caveolin-1 interacts with SH-PTP2.	BIND	12176037
CD33	FLJ00391 \| SIGLEC-3 \| SIGLEC3 \| p67	CD33 molecule	-	HPRD,BioGRID	10206955
CD84	DKFZp781E2378 \| LY9B \| SLAMF5 \| hCD84 \| mCD84	CD84 molecule	Affinity Capture-Western	BioGRID	11689425
CDH5	7B4 \| CD144 \| FLJ17376	cadherin 5, type 2 (vascular endothelium)	-	HPRD,BioGRID	10681592
CEACAM1	BGP \| BGP1 \| BGPI	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	-	HPRD,BioGRID	9867848 \|12108545
CRKL	-	v-crk sarcoma virus CT10 oncogene homolog (avian)-like	-	HPRD,BioGRID	9344843
CSF2RB	CD131 \| CDw131 \| IL3RB \| IL5RB	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	-	HPRD,BioGRID	9162089
CSF3R	CD114 \| GCSFR	colony stimulating factor 3 receptor (granulocyte)	-	HPRD,BioGRID	9824671
CTLA4	CD152 \| CELIAC3 \| CTLA-4 \| GSE \| IDDM12	cytotoxic T-lymphocyte-associated protein 4	-	HPRD,BioGRID	8638161
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	Affinity Capture-Western	BioGRID	10681592
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	-	HPRD,BioGRID	7673163
EPHA2	ECK	EPH receptor A2	Affinity Capture-Western	BioGRID	10655584
EPOR	MGC138358	erythropoietin receptor	-	HPRD,BioGRID	8639815
ERBB2	CD340 \| HER-2 \| HER-2/neu \| HER2 \| NEU \| NGL \| TKR1	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)	Affinity Capture-MS	BioGRID	16729043
ERBB4	HER4 \| MGC138404 \| p180erbB4	v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)	Affinity Capture-MS	BioGRID	16729043
FCRL3	FCRH3 \| IFGP3 \| IRTA3 \| SPAP2	Fc receptor-like 3	Reconstituted Complex	BioGRID	12051764
FLT1	FLT \| VEGFR1	fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)	Flt-1 interacts with the amino terminal SH2 domain of SHP-2.	BIND	9600074
FRS2	FRS2A \| FRS2alpha \| SNT \| SNT-1 \| SNT1	fibroblast growth factor receptor substrate 2	-	HPRD	9632781 \|11447289
FRS2	FRS2A \| FRS2alpha \| SNT \| SNT-1 \| SNT1	fibroblast growth factor receptor substrate 2	-	HPRD,BioGRID	9632781
FRS3	FRS2B \| FRS2beta \| MGC17167 \| SNT-2 \| SNT2	fibroblast growth factor receptor substrate 3	-	HPRD	11432792
FYN	MGC45350 \| SLK \| SYN	FYN oncogene related to SRC, FGR, YES	-	HPRD,BioGRID	10212213
GAB1	-	GRB2-associated binding protein 1	SHP2 interacts with and dephosphorylates Gab1.	BIND	12582165
GAB1	-	GRB2-associated binding protein 1	-	HPRD,BioGRID	11940581
GAB2	KIAA0571	GRB2-associated binding protein 2	-	HPRD	10068651 \|11287610
GAB2	KIAA0571	GRB2-associated binding protein 2	Affinity Capture-Western Two-hybrid	BioGRID	10391903 \|11334882 \|11782427 \|12135708
GAB3	-	GRB2-associated binding protein 3	-	HPRD,BioGRID	11739737
GHR	GHBP	growth hormone receptor	-	HPRD,BioGRID	10976913
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	Affinity Capture-Western Far Western Reconstituted Complex	BioGRID	8041791 \|8702859 \|8995399 \|9362449 \|9632781 \|9824671 \|10080542 \|10212213 \|10747947
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD	8041791 \|8702859 \|12531430
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	Grb2 interacts with Syp via Syp SH2 domains.	BIND	7523381 \|8195176
IFNAR1	AVP \| IFN-alpha-REC \| IFNAR \| IFNBR \| IFRC	interferon (alpha, beta and omega) receptor 1	-	HPRD	9029147
IGF1R	CD221 \| IGFIR \| JTK13 \| MGC142170 \| MGC142172 \| MGC18216	insulin-like growth factor 1 receptor	-	HPRD,BioGRID	7642582
IL4R	CD124 \| IL4RA	interleukin 4 receptor	-	HPRD,BioGRID	11714803
IL6ST	CD130 \| CDw130 \| GP130 \| GP130-RAPS \| IL6R-beta	interleukin 6 signal transducer (gp130, oncostatin M receptor)	-	HPRD,BioGRID	10946280
IL6ST	CD130 \| CDw130 \| GP130 \| GP130-RAPS \| IL6R-beta	interleukin 6 signal transducer (gp130, oncostatin M receptor)	-	HPRD	9195977
INPP5D	MGC104855 \| MGC142140 \| MGC142142 \| SHIP \| SHIP1 \| SIP-145 \| hp51CN	inositol polyphosphate-5-phosphatase, 145kDa	Affinity Capture-Western	BioGRID	9110989
INSR	CD220 \| HHF5	insulin receptor	-	HPRD,BioGRID	7493946 \|8135823
IRS1	HIRS-1	insulin receptor substrate 1	-	HPRD,BioGRID	8505282 \|9756938
IRS2	-	insulin receptor substrate 2	-	HPRD,BioGRID	8910607
IRS4	IRS-4 \| PY160	insulin receptor substrate 4	-	HPRD	12774026
JAK1	JAK1A \| JAK1B \| JTK3	Janus kinase 1 (a protein tyrosine kinase)	-	HPRD,BioGRID	8995399 \|11036942 \|12403768
JAK2	JTK10	Janus kinase 2 (a protein tyrosine kinase)	Biochemical Activity in vivo Reconstituted Complex	BioGRID	8639815 \|8912646 \|8995399
JAK2	JTK10	Janus kinase 2 (a protein tyrosine kinase)	-	HPRD	7559603 \|8912646 \|8995399
KIT	C-Kit \| CD117 \| PBT \| SCFR	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	-	HPRD,BioGRID	7523381 \|9528781
KIT	C-Kit \| CD117 \| PBT \| SCFR	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	Syp interacts with c-Kit via its SH2 domain.	BIND	7523381
KLRC1	CD159A \| MGC13374 \| MGC59791 \| NKG2 \| NKG2A	killer cell lectin-like receptor subfamily C, member 1	-	HPRD	9485206
LAIR1	CD305 \| LAIR-1	leukocyte-associated immunoglobulin-like receptor 1	-	HPRD,BioGRID	9285412
LCK	YT16 \| p56lck \| pp58lck	lymphocyte-specific protein tyrosine kinase	-	HPRD	10617656
LEPR	CD295 \| OBR	leptin receptor	-	HPRD	11018044
LIFR	CD118 \| FLJ98106 \| FLJ99923 \| LIF-R \| SJS2 \| STWS \| SWS	leukemia inhibitory factor receptor alpha	-	HPRD,BioGRID	10800945
LILRB4	CD85K \| HM18 \| ILT3 \| LILRB5 \| LIR-5 \| LIR5	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	-	HPRD	9422771
LILRB4	CD85K \| HM18 \| ILT3 \| LILRB5 \| LIR-5 \| LIR5	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	Protein-peptide	BioGRID	9973385
LY9	CD229 \| SLAMF3 \| hly9 \| mLY9	lymphocyte antigen 9	Affinity Capture-Western	BioGRID	11689425
MET	AUTS9 \| HGFR \| RCCP2 \| c-Met	met proto-oncogene (hepatocyte growth factor receptor)	-	HPRD	8662733
MPZL1	FLJ21047 \| PZR \| PZR1b \| PZRa \| PZRb	myelin protein zero-like 1	-	HPRD,BioGRID	9792637
NEDD9	CAS-L \| CAS2 \| CASL \| CASS2 \| HEF1 \| dJ49G10.2 \| dJ761I2.1	neural precursor cell expressed, developmentally down-regulated 9	-	HPRD	8879209
PAG1	CBP \| FLJ37858 \| MGC138364 \| PAG	phosphoprotein associated with glycosphingolipid microdomains 1	-	HPRD	10790433
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	Reconstituted Complex Two-hybrid	BioGRID	7691811 \|11266449
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	PDGFR interacts with Syp.	BIND	7688466
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	Autophosphorylated PDGFR interacts with Syp. This interaction was modelled on a demonstrated interaction between human PDGFR and Syp from an unspecified species.	BIND	8890167
PECAM1	CD31 \| PECAM-1	platelet/endothelial cell adhesion molecule	Affinity Capture-Western Far Western Reconstituted Complex	BioGRID	9054388 \|9774457 \|10350061 \|10801826
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	Affinity Capture-Western	BioGRID	9918857
PILRA	FDF03	paired immunoglobin-like type 2 receptor alpha	-	HPRD	10660620
PILRA	FDF03	paired immunoglobin-like type 2 receptor alpha	Affinity Capture-Western	BioGRID	10903717
PLCG2	-	phospholipase C, gamma 2 (phosphatidylinositol-specific)	Affinity Capture-Western	BioGRID	12135708
PRLR	hPRLrI	prolactin receptor	Affinity Capture-Western	BioGRID	10991949
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	-	HPRD,BioGRID	7589239 \|8986614 \|10082579 \|10655584
PTK2B	CADTK \| CAKB \| FADK2 \| FAK2 \| FRNK \| PKB \| PTK \| PYK2 \| RAFTK	PTK2B protein tyrosine kinase 2 beta	-	HPRD,BioGRID	10880513
PXN	FLJ16691	paxillin	-	HPRD	8986614 \|10082579 \|10655584
ROS1	MCF3 \| ROS \| c-ros-1	c-ros oncogene 1 , receptor tyrosine kinase	Two-hybrid	BioGRID	11266449
SELE	CD62E \| ELAM \| ELAM1 \| ESEL \| LECAM2	selectin E	-	HPRD,BioGRID	11602579
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD	10650943
SIGLEC11	-	sialic acid binding Ig-like lectin 11	-	HPRD,BioGRID	11986327
SIGLEC12	FLJ38600 \| S2V \| SIGLECL1 \| SLG \| Siglec-12 \| Siglec-L1 \| Siglec-XII	sialic acid binding Ig-like lectin 12	-	HPRD	11328818
SIGLEC7	AIRM1 \| CD328 \| CDw328 \| D-siglec \| QA79 \| SIGLEC-7 \| p75 \| p75/AIRM1	sialic acid binding Ig-like lectin 7	-	HPRD	10499918
SIT1	MGC125908 \| MGC125909 \| MGC125910 \| RP11-331F9.5 \| SIT	signaling threshold regulating transmembrane adaptor 1	-	HPRD,BioGRID	10209036 \|11433379 \|11491537
SLAMF1	CD150 \| CDw150 \| SLAM	signaling lymphocytic activation molecule family member 1	-	HPRD,BioGRID	11806999
SLAMF1	CD150 \| CDw150 \| SLAM	signaling lymphocytic activation molecule family member 1	CD150 interacts with SHP-2. This interaction was modelled on a demonstrated interaction between human CD150 and monkey SHP-2.	BIND	11477068
SLAMF6	KALI \| KALIb \| Ly108 \| MGC104953 \| NTB-A \| NTBA \| SF2000	SLAM family member 6	-	HPRD,BioGRID	11489943
SOCS3	ATOD4 \| CIS3 \| Cish3 \| MGC71791 \| SOCS-3 \| SSI-3 \| SSI3	suppressor of cytokine signaling 3	Affinity Capture-Western Reconstituted Complex	BioGRID	12403768
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	Affinity Capture-Western	BioGRID	9344843 \|9632781
STAT3	APRF \| FLJ20882 \| HIES \| MGC16063	signal transducer and activator of transcription 3 (acute-phase response factor)	-	HPRD,BioGRID	11594781
STAT5A	MGF \| STAT5	signal transducer and activator of transcription 5A	-	HPRD,BioGRID	12060651
STAT5B	STAT5	signal transducer and activator of transcription 5B	Biochemical Activity Reconstituted Complex	BioGRID	10617656
SYNCRIP	GRY-RBP \| HNRPQ1 \| NSAP1 \| RP1-3J17.2 \| dJ3J17.2 \| hnRNP-Q \| pp68	synaptotagmin binding, cytoplasmic RNA interacting protein	Two-hybrid	BioGRID	9847309
TEK	CD202B \| TIE-2 \| TIE2 \| VMCM \| VMCM1	TEK tyrosine kinase, endothelial	-	HPRD	10521483
TIE1	JTK14 \| TIE	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	-	HPRD	10949653
TNFRSF1A	CD120a \| FPF \| MGC19588 \| TBP1 \| TNF-R \| TNF-R-I \| TNF-R55 \| TNFAR \| TNFR1 \| TNFR55 \| TNFR60 \| p55 \| p55-R \| p60	tumor necrosis factor receptor superfamily, member 1A	-	HPRD	11786908
TREML1	GLTL1825 \| MGC119173 \| PRO3438 \| TLT-1 \| TLT1 \| dJ238O23.3	triggering receptor expressed on myeloid cells-like 1	-	HPRD,BioGRID	15128762

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG JAK STAT SIGNALING PATHWAY	155	105	All SZGR 2.0 genes in this pathway
KEGG NATURAL KILLER CELL MEDIATED CYTOTOXICITY	137	92	All SZGR 2.0 genes in this pathway
KEGG LEUKOCYTE TRANSENDOTHELIAL MIGRATION	118	78	All SZGR 2.0 genes in this pathway
KEGG NEUROTROPHIN SIGNALING PATHWAY	126	103	All SZGR 2.0 genes in this pathway
KEGG ADIPOCYTOKINE SIGNALING PATHWAY	67	57	All SZGR 2.0 genes in this pathway
KEGG EPITHELIAL CELL SIGNALING IN HELICOBACTER PYLORI INFECTION	68	44	All SZGR 2.0 genes in this pathway
KEGG RENAL CELL CARCINOMA	70	60	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
BIOCARTA IGF1 PATHWAY	21	16	All SZGR 2.0 genes in this pathway
BIOCARTA IL6 PATHWAY	22	16	All SZGR 2.0 genes in this pathway
BIOCARTA INSULIN PATHWAY	22	16	All SZGR 2.0 genes in this pathway
BIOCARTA MET PATHWAY	37	30	All SZGR 2.0 genes in this pathway
BIOCARTA CTLA4 PATHWAY	21	18	All SZGR 2.0 genes in this pathway
ST DIFFERENTIATION PATHWAY IN PC12 CELLS	45	35	All SZGR 2.0 genes in this pathway
PID FCER1 PATHWAY	62	43	All SZGR 2.0 genes in this pathway
PID INSULIN PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID GMCSF PATHWAY	37	31	All SZGR 2.0 genes in this pathway
PID TCR PATHWAY	66	51	All SZGR 2.0 genes in this pathway
PID MET PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID RET PATHWAY	39	29	All SZGR 2.0 genes in this pathway
PID ANGIOPOIETIN RECEPTOR PATHWAY	50	41	All SZGR 2.0 genes in this pathway
PID SHP2 PATHWAY	58	46	All SZGR 2.0 genes in this pathway
PID IL2 1PATHWAY	55	43	All SZGR 2.0 genes in this pathway
PID CXCR4 PATHWAY	102	78	All SZGR 2.0 genes in this pathway
PID IGF1 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID ERBB1 RECEPTOR PROXIMAL PATHWAY	35	29	All SZGR 2.0 genes in this pathway
PID IL5 PATHWAY	14	11	All SZGR 2.0 genes in this pathway
PID IL2 PI3K PATHWAY	34	27	All SZGR 2.0 genes in this pathway
PID AVB3 INTEGRIN PATHWAY	75	53	All SZGR 2.0 genes in this pathway
PID IFNG PATHWAY	40	34	All SZGR 2.0 genes in this pathway
PID ERBB2 ERBB3 PATHWAY	44	35	All SZGR 2.0 genes in this pathway
PID IL3 PATHWAY	27	19	All SZGR 2.0 genes in this pathway
PID IL6 7 PATHWAY	47	40	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID TRKR PATHWAY	62	48	All SZGR 2.0 genes in this pathway
PID VEGFR1 PATHWAY	26	23	All SZGR 2.0 genes in this pathway
PID KIT PATHWAY	52	40	All SZGR 2.0 genes in this pathway
PID EPO PATHWAY	34	29	All SZGR 2.0 genes in this pathway
PID IL2 STAT5 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID VEGFR1 2 PATHWAY	69	57	All SZGR 2.0 genes in this pathway
PID NCADHERIN PATHWAY	33	32	All SZGR 2.0 genes in this pathway
PID FGF PATHWAY	55	37	All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP	423	283	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL DN	86	59	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP	276	165	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP	341	197	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR DN	209	122	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP	722	443	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP	612	367	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP	309	199	All SZGR 2.0 genes in this pathway
TSAI RESPONSE TO IONIZING RADIATION	149	101	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN	411	249	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 60 HELA	46	32	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
DER IFN BETA RESPONSE UP	102	67	All SZGR 2.0 genes in this pathway
BROCKE APOPTOSIS REVERSED BY IL6	144	98	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP	151	100	All SZGR 2.0 genes in this pathway
MA MYELOID DIFFERENTIATION UP	39	29	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP	240	152	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR UP	225	139	All SZGR 2.0 genes in this pathway
ZHENG RESPONSE TO ARSENITE DN	18	15	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 8HR UP	105	73	All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC DN	228	146	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP	393	244	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN	220	147	All SZGR 2.0 genes in this pathway
OUYANG PROSTATE CANCER PROGRESSION DN	21	16	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN DN	249	165	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
BRUNEAU SEPTATION VENTRICULAR	10	8	All SZGR 2.0 genes in this pathway
BRUNEAU HEART GREAT VESSELS AND VALVULOGENESIS	8	8	All SZGR 2.0 genes in this pathway
WANG RECURRENT LIVER CANCER UP	20	13	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR UP	61	44	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR UP	55	41	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
AZARE NEOPLASTIC TRANSFORMATION BY STAT3 UP	121	70	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124/506	1752	1758	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	1752	1758	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-138	2277	2284	1A,m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-200bc/429	3739	3745	1A	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-496	3824	3831	1A,m8	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PTPN11