SZGR2

Summary ?

GeneID	5925
Symbol	RB1
Synonyms	OSRC\|PPP1R130\|RB\|p105-Rb\|pRb\|pp110
Description	retinoblastoma 1
Reference	MIM:614041\|HGNC:HGNC:9884\|Ensembl:ENSG00000139687\|HPRD:01574\|Vega:OTTHUMG00000016900
Gene type	protein-coding
Map location	13q14.2
Pascal p-value	0.02
Fetal beta	1.093

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0835

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SNX32	0.51	0.60
TCEAL5	0.50	0.52
PDZD4	0.49	0.54
PPP1R9B	0.48	0.51
KIFC2	0.48	0.53
TCAP	0.48	0.46
JAKMIP1	0.48	0.53
CCDC64	0.46	0.54
OGFR	0.46	0.47
SPEG	0.46	0.52

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MYL12A	-0.36	-0.44
AP002478.3	-0.32	-0.35
TM4SF1	-0.31	-0.30
GIMAP5	-0.31	-0.31
TTC38	-0.31	-0.30
MAPKAPK3	-0.31	-0.35
GJA4	-0.31	-0.32
ICAM2	-0.31	-0.32
C1orf54	-0.30	-0.35
CLDN5	-0.30	-0.35

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003674	molecular_function	ND		3413073
GO:0003700	transcription factor activity	TAS		3657987
GO:0003713	transcription coactivator activity	NAS		15572661
GO:0008134	transcription factor binding	IEA		-
GO:0016564	transcription repressor activity	IEA		-
GO:0019900	kinase binding	IDA		16286473
GO:0050681	androgen receptor binding	NAS		15572661
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000075	cell cycle checkpoint	TAS		10825186
GO:0000082	G1/S transition of mitotic cell cycle	IEA		-
GO:0000122	negative regulation of transcription from RNA polymerase II promoter	TAS		9491888
GO:0000279	M phase	NAS		7542657
GO:0006355	regulation of transcription, DNA-dependent	NAS		3413073
GO:0006350	transcription	IEA		-
GO:0006469	negative regulation of protein kinase activity	IPI		9858607
GO:0007050	cell cycle arrest	IEA		-
GO:0008285	negative regulation of cell proliferation	IEA		-
GO:0016568	chromatin modification	IEA		-
GO:0051146	striated muscle cell differentiation	IEA		-
GO:0051318	G1 phase	TAS		7542657
GO:0051301	cell division	IEA		-
GO:0030308	negative regulation of cell growth	TAS		7542657
GO:0043353	enucleate erythrocyte differentiation	IEA		-
GO:0030521	androgen receptor signaling pathway	NAS		15572661
GO:0045651	positive regulation of macrophage differentiation	IEA		-
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	IEA		-
GO:0045786	negative regulation of cell cycle	IEA		-
GO:0043550	regulation of lipid kinase activity	IDA		16286473
GO:0044419	interspecies interaction between organisms	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000785	chromatin	TAS		3657987
GO:0005819	spindle	IEA		-
GO:0005634	nucleus	NAS		3413073
GO:0005634	nucleus	TAS		3657987
GO:0005654	nucleoplasm	EXP		9190208 \|11931757 \|14527418
GO:0005667	transcription factor complex	IEA		-
GO:0016605	PML body	IDA		9448006

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AATF	CHE-1 \| CHE1 \| DED	apoptosis antagonizing transcription factor	-	HPRD,BioGRID	10783144 \|12450794
AATF	CHE-1 \| CHE1 \| DED	apoptosis antagonizing transcription factor	Che-1 interacts with Rb.	BIND	10783144
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	-	HPRD	7828850 \|8242749
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	Rb interacts with c-Abl	BIND	9632788
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	-	HPRD,BioGRID	8242749
AHR	-	aryl hydrocarbon receptor	-	HPRD,BioGRID	9712901
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	Rb interacts with AR.	BIND	9675141
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	-	HPRD,BioGRID	9675141
ARID3B	BDP \| DRIL2	AT rich interactive domain 3B (BRIGHT-like)	-	HPRD,BioGRID	10446990
ARID4A	RBBP1 \| RBP-1 \| RBP1	AT rich interactive domain 4A (RBP1-like)	-	HPRD,BioGRID	10321733 \|10490602
ARNT	HIF-1beta \| HIF1B \| HIF1BETA \| TANGO \| bHLHe2	aryl hydrocarbon receptor nuclear translocator	Affinity Capture-Western	BioGRID	9712901
ATF2	CRE-BP1 \| CREB2 \| HB16 \| MGC111558 \| TREB7	activating transcription factor 2	-	HPRD,BioGRID	1641004
ATF2	CRE-BP1 \| CREB2 \| HB16 \| MGC111558 \| TREB7	activating transcription factor 2	Rb interacts with ATF2. This interaction was modelled on a demonstrated interaction between Rb from an unspecified species and ATF2 from an unspecified species.	BIND	11566021
BAG1	RAP46	BCL2-associated athanogene	Affinity Capture-Western	BioGRID	12845674
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	Affinity Capture-Western	BioGRID	9071815
BDP1	DKFZp686C01233 \| DKFZp686K0831 \| HSA238520 \| KIAA1241 \| KIAA1689 \| TAF3B1 \| TFC5 \| TFIIIB'' \| TFIIIB150 \| TFIIIB90 \| TFNR	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	Rb interacts with TFIIIB90	BIND	9169441
BGLAP	BGP \| OC \| PMF1	bone gamma-carboxyglutamate (gla) protein	pRB interacts with OC promoter.	BIND	15949438
BIRC5	API4 \| EPR-1	baculoviral IAP repeat-containing 5	RB1 (pRB) interacts with the BIRC5 (survivin) promoter.	BIND	15271987
BNC2	BSN2 \| DKFZp686A01127 \| FLJ20043 \| FLJ34928	basonuclin 2	pRB interacts with BAA90908.	BIND	15949438
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	-	HPRD,BioGRID	10220405
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	BRCA1 interacts with Rb.	BIND	10518542
BRD2	D6S113E \| DKFZp686N0336 \| FLJ31942 \| FSH \| FSRG1 \| KIAA9001 \| NAT \| RING3 \| RNF3	bromodomain containing 2	pRB interacts with BRD2 promoter.	BIND	15949438
BRD8	SMAP \| SMAP2 \| p120	bromodomain containing 8	pRB interacts with BRD8 promoter.	BIND	15949438
BRF1	BRF \| FLJ42674 \| FLJ43034 \| GTF3B \| MGC105048 \| TAF3B2 \| TAF3C \| TAFIII90 \| TF3B90 \| TFIIIB90 \| hBRF	BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)	Affinity Capture-Western	BioGRID	11997511
CASP10	ALPS2 \| FLICE2 \| MCH4	caspase 10, apoptosis-related cysteine peptidase	CASP10 (caspase-10) cleaves RB-1 (hRB) at the DSID consensus site to produce the p68 form.	BIND	15735701
CASP2	CASP-2 \| ICH-1L \| ICH-1L/1S \| ICH1 \| NEDD2	caspase 2, apoptosis-related cysteine peptidase	CASP2 (caspase-2) cleaves RB-1 (hRB) at the DEAD consensus site into the p100 form.	BIND	15735701
CASP3	CPP32 \| CPP32B \| SCA-1	caspase 3, apoptosis-related cysteine peptidase	CASP3 (caspase-3) cleaves RB-1 (hRB) at the DEAD and DSID consensus sites to produce the p100, p68, p61 and p48 forms.	BIND	15735701
CASP6	MCH2	caspase 6, apoptosis-related cysteine peptidase	CASP6 (caspase-6) cleaves RB-1 (hRB) at the DSID consensus site to produce the p68 form.	BIND	15735701
CASP7	CMH-1 \| ICE-LAP3 \| MCH3	caspase 7, apoptosis-related cysteine peptidase	CASP7 (caspase-7) cleaves RB-1 (hRB) at the DEAD and DSID consensus sites to produce the p68, p61 and p48 forms.	BIND	15735701
CASP8	ALPS2B \| CAP4 \| FLICE \| FLJ17672 \| MACH \| MCH5 \| MGC78473	caspase 8, apoptosis-related cysteine peptidase	CASP8 (caspase-8) cleaves RB-1 (hRB) into the p68 form and to a lesser extent the p61 form.	BIND	15735701
CASP9	APAF-3 \| APAF3 \| CASPASE-9c \| ICE-LAP6 \| MCH6	caspase 9, apoptosis-related cysteine peptidase	CASP9 (caspase-9) cleaves RB-1 (hRB) at the LEND consensus site to produce the p76 form.	BIND	15735701
CBX1	CBX \| HP1-BETA \| HP1Hs-beta \| HP1Hsbeta \| M31 \| MOD1 \| p25beta	chromobox homolog 1 (HP1 beta homolog Drosophila )	Reconstituted Complex	BioGRID	12711675
CBX4	NBP16 \| PC2 \| hPC2	chromobox homolog 4 (Pc class homolog, Drosophila)	-	HPRD,BioGRID	11583618
CBX5	HP1 \| HP1A	chromobox homolog 5 (HP1 alpha homolog, Drosophila)	Affinity Capture-Western	BioGRID	11484059
CCNA1	-	cyclin A1	-	HPRD,BioGRID	10022926
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	Rb interacts with Cyclin D1. This interaction was modelled on a demonstrated interaction between Cyclin D1 from mouse and Rb from human.	BIND	11126356
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	-	HPRD,BioGRID	8490963
CCND3	-	cyclin D3	Two-hybrid	BioGRID	17972097
CCNT2	FLJ90560 \| MGC134840	cyclin T2	-	HPRD,BioGRID	12037672
CDK2	p33(CDK2)	cyclin-dependent kinase 2	CDK2 phosphorylates Rb carboxy-terminus.	BIND	15241418
CDK2	p33(CDK2)	cyclin-dependent kinase 2	Biochemical Activity	BioGRID	10938106
CDK4	CMM3 \| MGC14458 \| PSK-J3	cyclin-dependent kinase 4	CDK4 phosphorylates Rb carboxy-terminus. This interaction was modelled on a demonstrated interaction between human Rb and mouse CDK4.	BIND	15241418
CDK6	MGC59692 \| PLSTIRE \| STQTL11	cyclin-dependent kinase 6	CDK6 phosphorylates Rb. This interaction was modeled on a demonstrated interaction between CDK6 and Rb, both from an unspecified species.	BIND	7629134
CDK6	MGC59692 \| PLSTIRE \| STQTL11	cyclin-dependent kinase 6	Cdk6 phosphorylates Rb	BIND	10339564
CDK9	C-2k \| CDC2L4 \| CTK1 \| PITALRE \| TAK	cyclin-dependent kinase 9	Affinity Capture-Western Reconstituted Complex	BioGRID	12037672
CDKN1A	CAP20 \| CDKN1 \| CIP1 \| MDA-6 \| P21 \| SDI1 \| WAF1 \| p21CIP1	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	Rb interacts with the p21 promoter.	BIND	15716956
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	-	HPRD,BioGRID	11596110
CEBPD	C/EBP-delta \| CELF \| CRP3 \| NF-IL6-beta	CCAAT/enhancer binding protein (C/EBP), delta	C/EBP-delta interacts with Rb.	BIND	15674331
CEBPE	C/EBP-epsilon \| CRP1	CCAAT/enhancer binding protein (C/EBP), epsilon	Rb interacts with C/EBPepsilon.	BIND	12947005
CREG1	CREG	cellular repressor of E1A-stimulated genes 1	-	HPRD,BioGRID	9710587
CTBP1	BARS \| MGC104684	C-terminal binding protein 1	-	HPRD	11583618
CUX1	CASP \| CDP \| CDP/Cut \| CDP1 \| COY1 \| CUTL1 \| CUX \| Clox \| Cux/CDP \| GOLIM6 \| Nbla10317 \| p100 \| p110 \| p200 \| p75	cut-like homeobox 1	-	HPRD,BioGRID	12891711
DNMT1	AIM \| CXXC9 \| DNMT \| FLJ16293 \| MCMT \| MGC104992	DNA (cytosine-5-)-methyltransferase 1	Rb interacts with hDnmt1.	BIND	11847125
DNMT1	AIM \| CXXC9 \| DNMT \| FLJ16293 \| MCMT \| MGC104992	DNA (cytosine-5-)-methyltransferase 1	-	HPRD,BioGRID	10888886
DNMT3A	DNMT3A2 \| M.HsaIIIA	DNA (cytosine-5-)-methyltransferase 3 alpha	Reconstituted Complex	BioGRID	11350943
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	pRB interacts with E2F-1.	BIND	15949438
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	pRB interacts with E2F1.	BIND	8816797 \|8816798
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	7739537 \|8230483 \|8896460 \|9422723 \|10869426 \|11470869 \|12397079
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	pRb interacts with E2F1.	BIND	15619620
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	E2F1 (RBP3) interacts with pRB.	BIND	1638634
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	-	HPRD	1388726 \|11583618
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	Rb interacts with E2F-1.	BIND	8346196
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	Rb interacts with E2F	BIND	9632788
E2F2	E2F-2	E2F transcription factor 2	E2F-2 interacts with pRb.	BIND	8246996
E2F2	E2F-2	E2F transcription factor 2	-	HPRD,BioGRID	12502741
E2F2	E2F-2	E2F transcription factor 2	E2F1 interacts with pRb.	BIND	8246996
E2F2	E2F-2	E2F transcription factor 2	pRB interacts with E2F-2.	BIND	15949438
E2F4	E2F-4	E2F transcription factor 4, p107/p130-binding	Two-hybrid	BioGRID	10869426
E2F4	E2F-4	E2F transcription factor 4, p107/p130-binding	-	HPRD	8657117
E4F1	E4F \| MGC99614	E4F transcription factor 1	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	10869426
EID1	C15orf3 \| CRI1 \| EID-1 \| IRO45620 \| MGC138883 \| MGC138884 \| PNAS-22 \| PTD014 \| RBP21	EP300 interacting inhibitor of differentiation 1	pRB interacts with EID-1.	BIND	15949438
EID1	C15orf3 \| CRI1 \| EID-1 \| IRO45620 \| MGC138883 \| MGC138884 \| PNAS-22 \| PTD014 \| RBP21	EP300 interacting inhibitor of differentiation 1	RB1 (pRb) interacts with CRI1 (EID-1).	BIND	15806172
EID1	C15orf3 \| CRI1 \| EID-1 \| IRO45620 \| MGC138883 \| MGC138884 \| PNAS-22 \| PTD014 \| RBP21	EP300 interacting inhibitor of differentiation 1	-	HPRD,BioGRID	11073989 \|11073990
ELF1	-	E74-like factor 1 (ets domain transcription factor)	-	HPRD	8493578
ENC1	CCL28 \| ENC-1 \| FLJ39259 \| KLHL35 \| KLHL37 \| NRPB \| PIG10 \| TP53I10	ectodermal-neural cortex (with BTB-like domain)	-	HPRD,BioGRID	9566959
EPO	EP \| MGC138142	erythropoietin	RB1 (pRB) interacts with the EPO gene 3(prime) enhancer.	BIND	15674338
FOS	AP-1 \| C-FOS	v-fos FBJ murine osteosarcoma viral oncogene homolog	-	HPRD	8475068
FRK	GTK \| PTK5 \| RAK	fyn-related kinase	-	HPRD,BioGRID	7664264
FRK	GTK \| PTK5 \| RAK	fyn-related kinase	pRB interacts with Rak.	BIND	7664264
GNB2L1	Gnb2-rs1 \| H12.3 \| HLC-7 \| PIG21 \| RACK1	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1	-	HPRD,BioGRID	12761493
GNB2L1	Gnb2-rs1 \| H12.3 \| HLC-7 \| PIG21 \| RACK1	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1	RACK1 interacts with Rb	BIND	12761493
GTF3C2	KIAA0011 \| TFIIIC-BETA \| TFIIIC110	general transcription factor IIIC, polypeptide 2, beta 110kDa	Rb interacts with TFIIIC2	BIND	9169441
HBP1	FLJ16340	HMG-box transcription factor 1	-	HPRD,BioGRID	9178770
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	RB interacts with HDAC1.	BIND	11447271
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	-	HPRD	9491888 \|10888886 \|11896613 \|11909966
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	The Retinoblastoma protein interacts with Histone Deacetylase 1.	BIND	10734134
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	Affinity Capture-Western Reconstituted Complex	BioGRID	9491888 \|9724731 \|10490602 \|10615135 \|10779361 \|11684023 \|12466959
HDAC2	RPD3 \| YAF1	histone deacetylase 2	Affinity Capture-Western	BioGRID	10490602
HDAC3	HD3 \| RPD3 \| RPD3-2	histone deacetylase 3	-	HPRD,BioGRID	12479814
HIF1A	HIF-1alpha \| HIF1 \| HIF1-ALPHA \| MOP1 \| PASD8	hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	RB1 (pRB) interacts with HIF1A (HIF-1-alpha).	BIND	15674338
HMGB1	DKFZp686A04236 \| HMG1 \| HMG3 \| SBP-1	high-mobility group box 1	HMGB1 interacts with RB1 (pRB). This interaction was modelled on a demonstrated interaction between rat HMGB1 and human RB1 (pRB).	BIND	11748221
HMGB1	DKFZp686A04236 \| HMG1 \| HMG3 \| SBP-1	high-mobility group box 1	-	HPRD,BioGRID	11748221
HSPA8	HSC54 \| HSC70 \| HSC71 \| HSP71 \| HSP73 \| HSPA10 \| LAP1 \| MGC131511 \| MGC29929 \| NIP71	heat shock 70kDa protein 8	-	HPRD	7673249
JARID1A	KDM5A \| RBBP2 \| RBP2	jumonji, AT rich interactive domain 1A	-	HPRD,BioGRID	7935440
JARID1A	KDM5A \| RBBP2 \| RBP2	jumonji, AT rich interactive domain 1A	Rbp2 interacts with Rb. This interaction was modeled on a demonstrated interaction between human Rbp2 and Rb from an unspecified species.	BIND	11358960
JARID1A	KDM5A \| RBBP2 \| RBP2	jumonji, AT rich interactive domain 1A	pRB interacts with RBP2.	BIND	15949438
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	-	HPRD,BioGRID	10026157
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	RB interacts with c-Jun.	BIND	10026157
KAT2B	CAF \| P \| P/CAF \| PCAF	K(lysine) acetyltransferase 2B	pRb interacts with the acetyltransferase domain of P/CAF.	BIND	15044952
LIN37	F25965 \| MGC9505 \| ZK418.4 \| lin-37	lin-37 homolog (C. elegans)	pRb interacts with hMip40.	BIND	15479636
LIN54	CXCDC1 \| DKFZp686L1814 \| JC8.6 \| MGC129905 \| MIP120	lin-54 homolog (C. elegans)	pRb interacts with hMip120.	BIND	15479636
LIN9	BARA \| BARPsv \| Lin-9 \| TGS \| TGS1	lin-9 homolog (C. elegans)	pRb interacts with hMip130/TWIT.	BIND	15479636
LIN9	BARA \| BARPsv \| Lin-9 \| TGS \| TGS1	lin-9 homolog (C. elegans)	-	HPRD,BioGRID	15538385
LMNA	CDCD1 \| CDDC \| CMD1A \| CMT2B1 \| EMD2 \| FPL \| FPLD \| HGPS \| IDC \| LDP1 \| LFP \| LGMD1B \| LMN1 \| LMNC \| PRO1	lamin A/C	-	HPRD,BioGRID	8058329 \|8278403
LMNA	CDCD1 \| CDDC \| CMD1A \| CMT2B1 \| EMD2 \| FPL \| FPLD \| HGPS \| IDC \| LDP1 \| LFP \| LGMD1B \| LMN1 \| LMNC \| PRO1	lamin A/C	Rb interacts with lamin C	BIND	12475961
MAPK1	ERK \| ERK2 \| ERT1 \| MAPK2 \| P42MAPK \| PRKM1 \| PRKM2 \| p38 \| p40 \| p41 \| p41mapk	mitogen-activated protein kinase 1	RB1 is phosphorylated by MAPK1. This interaction was modeled on a demonstrated interaction between human KIAA1536 and MAPK1 from an unspecified species.	BIND	15489336
MAPK9	JNK-55 \| JNK2 \| JNK2A \| JNK2ALPHA \| JNK2B \| JNK2BETA \| PRKM9 \| SAPK \| p54a \| p54aSAPK	mitogen-activated protein kinase 9	Rb interacts with JNK2. This interaction was modelled on a demonstrated interaction between Rb from an unspecified species and JNK2 from an unspecified species.	BIND	11566021
MCM7	CDABP0042 \| CDC47 \| MCM2 \| P1.1-MCM3 \| P1CDC47 \| P85MCM \| PNAS-146	minichromosome maintenance complex component 7	-	HPRD,BioGRID	9566894
MCM7	CDABP0042 \| CDC47 \| MCM2 \| P1.1-MCM3 \| P1CDC47 \| P85MCM \| PNAS-146	minichromosome maintenance complex component 7	MCM7 interacts with Rb.	BIND	9566894
MDM2	HDMX \| MGC71221 \| hdm2	Mdm2 p53 binding protein homolog (mouse)	-	HPRD,BioGRID	7791904\|10078201 \|10721693
MDM2	HDMX \| MGC71221 \| hdm2	Mdm2 p53 binding protein homolog (mouse)	Rb interacts with Mdm2.	BIND	15577944
MDM2	HDMX \| MGC71221 \| hdm2	Mdm2 p53 binding protein homolog (mouse)	Rb interacts with MDM2.	BIND	15485814
MDM4	DKFZp781B1423 \| HDMX \| MDMX \| MGC132766 \| MRP1	Mdm4 p53 binding protein homolog (mouse)	pRb interacts with MDMX. This interaction was modeled on a demonstrated interaction between mouse MDMX and human pRb.	BIND	12532331
MITF	MI \| WS2A \| bHLHe32	microphthalmia-associated transcription factor	An unspecified isoform of Mitf interacts with Rb.	BIND	15716956
MNAT1	MAT1 \| RNF66 \| TFB3	menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)	-	HPRD,BioGRID	11113200
MORF4L1	Eaf3 \| FWP006 \| HsT17725 \| MGC10631 \| MORFRG15 \| MRG15 \| S863-6	mortality factor 4 like 1	-	HPRD,BioGRID	11500496 \|12397079
MORF4L2	KIAA0026 \| MORFL2 \| MRGX	mortality factor 4 like 2	-	HPRD,BioGRID	14506250
MRFAP1	PAM14 \| PGR1	Mof4 family associated protein 1	Affinity Capture-Western Co-purification	BioGRID	11500496 \|12397079
MT1G	MGC12386 \| MT1 \| MT1K	metallothionein 1G	RB1 interacts with the MT1G promoter.	BIND	15735762
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	-	HPRD,BioGRID	7838535
MYOD1	MYF3 \| MYOD \| PUM \| bHLHc1	myogenic differentiation 1	-	HPRD,BioGRID	8381715
NCOA6	AIB3 \| ANTP \| ASC2 \| HOX1.1 \| HOXA7 \| KIAA0181 \| NRC \| PRIP \| RAP250 \| TRBP	nuclear receptor coactivator 6	Rb interacts with ASC-2.	BIND	14645241
NCOA6	AIB3 \| ANTP \| ASC2 \| HOX1.1 \| HOXA7 \| KIAA0181 \| NRC \| PRIP \| RAP250 \| TRBP	nuclear receptor coactivator 6	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	14645241
NDC80	HEC \| HEC1 \| KNTC2 \| TID3 \| hsNDC80	NDC80 homolog, kinetochore complex component (S. cerevisiae)	-	HPRD,BioGRID	10409732
NFIX	NF1A	nuclear factor I/X (CCAAT-binding transcription factor)	Affinity Capture-Western	BioGRID	11896613
PA2G4	EBP1 \| HG4-1 \| p38-2G4	proliferation-associated 2G4, 38kDa	-	HPRD,BioGRID	11268000
PAX6	AN \| AN2 \| D11S812E \| MGC17209 \| MGDA \| WAGR	paired box 6	Reconstituted Complex	BioGRID	10359315
PELP1	HMX3 \| MNAR \| P160	proline, glutamate and leucine rich protein 1	-	HPRD,BioGRID	12682072
PELP1	HMX3 \| MNAR \| P160	proline, glutamate and leucine rich protein 1	PELP1 interacts with pRb.	BIND	12682072
PHB	PHB1	prohibitin	-	HPRD,BioGRID	10376528
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	Rb interacts with p55alpha	BIND	12588990
PIK3R3	DKFZp686P05226 \| FLJ41892 \| p55 \| p55-GAMMA	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)	-	HPRD,BioGRID	12588990
PIK3R3	DKFZp686P05226 \| FLJ41892 \| p55 \| p55-GAMMA	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)	Rb interacts with PI3K regulatory subunit p55gamma	BIND	12588990
PML	MYL \| PP8675 \| RNF71 \| TRIM19	promyelocytic leukemia	-	HPRD,BioGRID	9448006
POLA1	DKFZp686K1672 \| POLA \| p180	polymerase (DNA directed), alpha 1, catalytic subunit	-	HPRD,BioGRID	9395244
PPARG	NR1C3 \| PPARG1 \| PPARG2 \| PPARgamma	peroxisome proliferator-activated receptor gamma	Affinity Capture-Western Reconstituted Complex	BioGRID	12479814
PPIA	CYPA \| CYPH \| MGC117158 \| MGC12404 \| MGC23397	peptidylprolyl isomerase A (cyclophilin A)	Rb interacts with CypA.	BIND	12210730
PRDM2	HUMHOXY1 \| KMT8 \| MTB-ZF \| RIZ \| RIZ1 \| RIZ2	PR domain containing 2, with ZNF domain	-	HPRD,BioGRID	7538672
PRKRA	DYT16 \| HSD14 \| PACT \| RAX	protein kinase, interferon-inducible double stranded RNA dependent activator	-	HPRD,BioGRID	9010216
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	-	HPRD,BioGRID	9819434
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	Raf-1 interacts with Rb.	BIND	9819434
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	-	HPRD	12502741
RBAK	ZNF769	RB-associated KRAB zinc finger	-	HPRD	10702291
RBBP4	NURF55 \| RBAP48	retinoblastoma binding protein 4	The retinoblastoma protein 1 (Rb) interacts with RbAp48	BIND	7503932
RBBP4	NURF55 \| RBAP48	retinoblastoma binding protein 4	-	HPRD,BioGRID	7503932
RBBP5	RBQ3 \| SWD1	retinoblastoma binding protein 5	-	HPRD,BioGRID	7558034
RBBP7	MGC138867 \| MGC138868 \| RbAp46	retinoblastoma binding protein 7	-	HPRD,BioGRID	7503932
RBBP7	MGC138867 \| MGC138868 \| RbAp46	retinoblastoma binding protein 7	The retinoblastoma protein, Rb, interacts with RbAp46.	BIND	7503932
RBBP8	CTIP \| RIM	retinoblastoma binding protein 8	-	HPRD,BioGRID	9721205
RBBP9	BOG \| MGC9236 \| RBBP10	retinoblastoma binding protein 9	-	HPRD,BioGRID	9697699
RBL1	CP107 \| MGC40006 \| PRB1 \| p107	retinoblastoma-like 1 (p107)	Rb interacts with the p107 promoter.	BIND	15716956
RBL1	CP107 \| MGC40006 \| PRB1 \| p107	retinoblastoma-like 1 (p107)	Affinity Capture-Western	BioGRID	10490602
RBL2	FLJ26459 \| P130 \| Rb2	retinoblastoma-like 2 (p130)	Affinity Capture-Western	BioGRID	10490602
RFC1	A1 \| MGC51786 \| MHCBFB \| PO-GA \| RECC1 \| RFC \| RFC140	replication factor C (activator 1) 1, 145kDa	Affinity Capture-Western	BioGRID	10353443
RING1	RING1A \| RNF1	ring finger protein 1	-	HPRD,BioGRID	11583618
RUNX2	AML3 \| CBFA1 \| CCD \| CCD1 \| MGC120022 \| MGC120023 \| OSF2 \| PEA2aA \| PEBP2A1 \| PEBP2A2 \| PEBP2aA \| PEBP2aA1	runt-related transcription factor 2	Runx2 interacts with pRb.	BIND	15583032
SERPINB2	HsT1201 \| PAI \| PAI-2 \| PAI2 \| PLANH2	serpin peptidase inhibitor, clade B (ovalbumin), member 2	-	HPRD,BioGRID	12944478
SERPINB2	HsT1201 \| PAI \| PAI-2 \| PAI2 \| PLANH2	serpin peptidase inhibitor, clade B (ovalbumin), member 2	Rb interacts with PAI-2.	BIND	12944478
SKP2	FBL1 \| FBXL1 \| FLB1 \| MGC1366	S-phase kinase-associated protein 2 (p45)	Skp2 interacts with Rb.	BIND	15469821
SMARCA4	BAF190 \| BRG1 \| FLJ39786 \| SNF2 \| SNF2-BETA \| SNF2L4 \| SNF2LB \| SWI2 \| hSNF2b	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	-	HPRD,BioGRID	7923370
SMARCB1	BAF47 \| INI1 \| RDT \| SNF5 \| SNF5L1 \| Sfh1p \| Snr1 \| hSNFS	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	-	HPRD	11085541
SNAPC1	PTFgamma \| SNAP43	small nuclear RNA activating complex, polypeptide 1, 43kDa	Rb interacts with SNAP43	BIND	11094070
SNAPC1	PTFgamma \| SNAP43	small nuclear RNA activating complex, polypeptide 1, 43kDa	Affinity Capture-Western Reconstituted Complex	BioGRID	11094070
SNAPC3	MGC132011 \| MGC33124 \| PTFbeta \| SNAP50	small nuclear RNA activating complex, polypeptide 3, 50kDa	Rb interacts with SNAP50	BIND	11094070
SNAPC3	MGC132011 \| MGC33124 \| PTFbeta \| SNAP50	small nuclear RNA activating complex, polypeptide 3, 50kDa	-	HPRD,BioGRID	11094070
SNW1	Bx42 \| MGC119379 \| NCOA-62 \| PRPF45 \| Prp45 \| SKIIP \| SKIP	SNW domain containing 1	Reconstituted Complex	BioGRID	12466551
SP1	-	Sp1 transcription factor	-	HPRD	7732011
SP1	-	Sp1 transcription factor	Affinity Capture-Western	BioGRID	11896613
SP3	DKFZp686O1631 \| SPR-2	Sp3 transcription factor	-	HPRD	7732011
SPIB	SPI-B	Spi-B transcription factor (Spi-1/PU.1 related)	-	HPRD	10196196
SUV39H1	KMT1A \| MG44 \| SUV39H	suppressor of variegation 3-9 homolog 1 (Drosophila)	-	HPRD,BioGRID	11484059 \|11533237
TAF1	BA2R \| CCG1 \| CCGS \| DYT3 \| KAT4 \| N-TAF1 \| NSCL2 \| OF \| P250 \| TAF2A \| TAFII250	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	TAFII250 interacts with Rb.	BIND	11126356
TAF1	BA2R \| CCG1 \| CCGS \| DYT3 \| KAT4 \| N-TAF1 \| NSCL2 \| OF \| P250 \| TAF2A \| TAFII250	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	-	HPRD,BioGRID	7724524 \|9242374 \|9858607
TBP	GTF2D \| GTF2D1 \| MGC117320 \| MGC126054 \| MGC126055 \| SCA17 \| TFIID	TATA box binding protein	Rb interacts with TBP	BIND	11094070
TFDP1	DP1 \| DRTF1 \| Dp-1	transcription factor Dp-1	Affinity Capture-Western	BioGRID	7739537
TFDP2	DP2 \| Dp-2	transcription factor Dp-2 (E2F dimerization partner 2)	Affinity Capture-Western	BioGRID	7739537
TGM2	G-ALPHA-h \| GNAH \| TG2 \| TGC	transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)	-	HPRD,BioGRID	9315663
THOC1	HPR1 \| P84 \| P84N5	THO complex 1	-	HPRD,BioGRID	7525595
TMPO	CMD1T \| LAP2 \| LEMD4 \| MGC61508 \| PRO0868 \| TP	thymopoietin	Rb interacts with LAP2alpha	BIND	12475961
TMPO	CMD1T \| LAP2 \| LEMD4 \| MGC61508 \| PRO0868 \| TP	thymopoietin	-	HPRD,BioGRID	12475961
TP73	P73	tumor protein p73	Affinity Capture-Western	BioGRID	12761493
TRAP1	HSP75 \| HSP90L	TNF receptor-associated protein 1	-	HPRD,BioGRID	8756626
TRIP11	CEV14 \| GMAP-210 \| TRIP230	thyroid hormone receptor interactor 11	-	HPRD,BioGRID	9256431
TYR	OCA1A \| OCAIA \| SHEP3	tyrosinase (oculocutaneous albinism IA)	Rb interacts with the TYR promoter.	BIND	15716956
UBE2I	C358B7.1 \| P18 \| UBC9	ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	RB1 (pRb) interacts with, and is sumoylated by, an unspecified isoform of UBE2I (Ubc9).	BIND	15806172
UBTF	NOR-90 \| UBF	upstream binding transcription factor, RNA polymerase I	-	HPRD,BioGRID	11042686
VDR	NR1I1	vitamin D (1,25- dihydroxyvitamin D3) receptor	Reconstituted Complex	BioGRID	11358960
VEGFA	MGC70609 \| VEGF \| VEGF-A \| VPF	vascular endothelial growth factor A	RB1 (pRB) interacts with the VEGF promoter.	BIND	15674338
ZBTB16	PLZF \| ZNF145	zinc finger and BTB domain containing 16	pRB interacts with PLZF.	BIND	15949438

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CELL CYCLE	128	84	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG PANCREATIC CANCER	70	56	All SZGR 2.0 genes in this pathway
KEGG GLIOMA	65	56	All SZGR 2.0 genes in this pathway
KEGG PROSTATE CANCER	89	75	All SZGR 2.0 genes in this pathway
KEGG MELANOMA	71	57	All SZGR 2.0 genes in this pathway
KEGG BLADDER CANCER	42	33	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
KEGG SMALL CELL LUNG CANCER	84	67	All SZGR 2.0 genes in this pathway
KEGG NON SMALL CELL LUNG CANCER	54	47	All SZGR 2.0 genes in this pathway
BIOCARTA G1 PATHWAY	28	21	All SZGR 2.0 genes in this pathway
BIOCARTA TID PATHWAY	19	15	All SZGR 2.0 genes in this pathway
BIOCARTA CELLCYCLE PATHWAY	23	15	All SZGR 2.0 genes in this pathway
BIOCARTA SKP2E2F PATHWAY	10	6	All SZGR 2.0 genes in this pathway
BIOCARTA FAS PATHWAY	30	22	All SZGR 2.0 genes in this pathway
BIOCARTA HIVNEF PATHWAY	58	43	All SZGR 2.0 genes in this pathway
BIOCARTA HCMV PATHWAY	17	16	All SZGR 2.0 genes in this pathway
BIOCARTA RACCYCD PATHWAY	26	23	All SZGR 2.0 genes in this pathway
BIOCARTA PPARA PATHWAY	58	43	All SZGR 2.0 genes in this pathway
BIOCARTA P53 PATHWAY	16	13	All SZGR 2.0 genes in this pathway
BIOCARTA RB PATHWAY	13	11	All SZGR 2.0 genes in this pathway
BIOCARTA P27 PATHWAY	13	10	All SZGR 2.0 genes in this pathway
BIOCARTA PML PATHWAY	17	12	All SZGR 2.0 genes in this pathway
BIOCARTA TEL PATHWAY	18	15	All SZGR 2.0 genes in this pathway
BIOCARTA TNFR1 PATHWAY	29	21	All SZGR 2.0 genes in this pathway
BIOCARTA ARF PATHWAY	17	13	All SZGR 2.0 genes in this pathway
PID P73PATHWAY	79	59	All SZGR 2.0 genes in this pathway
PID E2F PATHWAY	74	48	All SZGR 2.0 genes in this pathway
PID CERAMIDE PATHWAY	48	37	All SZGR 2.0 genes in this pathway
PID P53 DOWNSTREAM PATHWAY	137	94	All SZGR 2.0 genes in this pathway
PID ATF2 PATHWAY	59	43	All SZGR 2.0 genes in this pathway
PID FOXM1 PATHWAY	40	30	All SZGR 2.0 genes in this pathway
PID RB 1PATHWAY	65	46	All SZGR 2.0 genes in this pathway
PID HES HEY PATHWAY	48	39	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE	421	253	All SZGR 2.0 genes in this pathway
REACTOME ORC1 REMOVAL FROM CHROMATIN	67	37	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE MITOTIC	325	185	All SZGR 2.0 genes in this pathway
REACTOME CYCLIN E ASSOCIATED EVENTS DURING G1 S TRANSITION	65	40	All SZGR 2.0 genes in this pathway
REACTOME G1 PHASE	38	23	All SZGR 2.0 genes in this pathway
REACTOME G1 S TRANSITION	112	63	All SZGR 2.0 genes in this pathway
REACTOME SYNTHESIS OF DNA	92	53	All SZGR 2.0 genes in this pathway
REACTOME MITOTIC G1 G1 S PHASES	137	79	All SZGR 2.0 genes in this pathway
REACTOME INHIBITION OF REPLICATION INITIATION OF DAMAGED DNA BY RB1 E2F1	13	6	All SZGR 2.0 genes in this pathway
REACTOME DNA REPLICATION	192	110	All SZGR 2.0 genes in this pathway
REACTOME E2F MEDIATED REGULATION OF DNA REPLICATION	35	17	All SZGR 2.0 genes in this pathway
REACTOME S PHASE	109	66	All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA PROGENITOR DN	66	42	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN	463	290	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP	185	126	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
MARKEY RB1 CHRONIC LOF DN	118	78	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP	612	367	All SZGR 2.0 genes in this pathway
BARIS THYROID CANCER DN	59	45	All SZGR 2.0 genes in this pathway
TAKADA GASTRIC CANCER COPY NUMBER DN	29	15	All SZGR 2.0 genes in this pathway
MARKS ACETYLATED NON HISTONE PROTEINS	15	9	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION HBZ	41	27	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION HEMGN	31	21	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER UP	227	137	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP	414	287	All SZGR 2.0 genes in this pathway
TSAI RESPONSE TO IONIZING RADIATION	149	101	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK	101	73	All SZGR 2.0 genes in this pathway
PUJANA XPRSS INT NETWORK	168	103	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
PUJANA BRCA CENTERED NETWORK	117	72	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
FRIDMAN IMMORTALIZATION DN	34	24	All SZGR 2.0 genes in this pathway
HE PTEN TARGETS UP	16	15	All SZGR 2.0 genes in this pathway
GEORGES CELL CYCLE MIR192 TARGETS	62	46	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 7	27	22	All SZGR 2.0 genes in this pathway
MORI SMALL PRE BII LYMPHOCYTE UP	86	57	All SZGR 2.0 genes in this pathway
TCGA GLIOBLASTOMA COPY NUMBER DN	31	21	All SZGR 2.0 genes in this pathway
DING LUNG CANCER MUTATED SIGNIFICANTLY	26	22	All SZGR 2.0 genes in this pathway
DING LUNG CANCER MUTATED FREQUENTLY	12	10	All SZGR 2.0 genes in this pathway
MANALO HYPOXIA DN	289	166	All SZGR 2.0 genes in this pathway
BROCKE APOPTOSIS REVERSED BY IL6	144	98	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST DN	309	206	All SZGR 2.0 genes in this pathway
PENG GLUCOSE DEPRIVATION DN	169	112	All SZGR 2.0 genes in this pathway
REN BOUND BY E2F	61	40	All SZGR 2.0 genes in this pathway
MAGRANGEAS MULTIPLE MYELOMA IGLL VS IGLK UP	42	24	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP	555	346	All SZGR 2.0 genes in this pathway
HASLINGER B CLL WITH 13Q14 DELETION	24	18	All SZGR 2.0 genes in this pathway
HOFMANN CELL LYMPHOMA UP	50	35	All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR	293	193	All SZGR 2.0 genes in this pathway
ABRAHAM ALPC VS MULTIPLE MYELOMA UP	26	22	All SZGR 2.0 genes in this pathway
MA MYELOID DIFFERENTIATION UP	39	29	All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION	405	264	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY TBH AND H2O2	36	24	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP	244	165	All SZGR 2.0 genes in this pathway
HU GENOTOXIN ACTION DIRECT VS INDIRECT 24HR	55	38	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 8HR UP	105	73	All SZGR 2.0 genes in this pathway
JI RESPONSE TO FSH DN	58	43	All SZGR 2.0 genes in this pathway
DELASERNA MYOD TARGETS UP	89	51	All SZGR 2.0 genes in this pathway
ZHU CMV ALL UP	120	89	All SZGR 2.0 genes in this pathway
KUNINGER IGF1 VS PDGFB TARGETS UP	82	51	All SZGR 2.0 genes in this pathway
ZHU CMV 24 HR UP	93	65	All SZGR 2.0 genes in this pathway
MAHAJAN RESPONSE TO IL1A UP	81	52	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
CHENG IMPRINTED BY ESTRADIOL	110	68	All SZGR 2.0 genes in this pathway
DE YY1 TARGETS DN	92	64	All SZGR 2.0 genes in this pathway
DAIRKEE CANCER PRONE RESPONSE BPA	51	35	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING	510	309	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP	259	185	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
MCMURRAY TP53 HRAS COOPERATION RESPONSE DN	67	46	All SZGR 2.0 genes in this pathway
ZHAN V1 LATE DIFFERENTIATION GENES UP	32	25	All SZGR 2.0 genes in this pathway
ISHIDA E2F TARGETS	53	27	All SZGR 2.0 genes in this pathway
TCGA GLIOBLASTOMA MUTATED	8	8	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
KUROKAWA LIVER CANCER EARLY RECURRENCE DN	7	6	All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN	253	192	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14	143	86	All SZGR 2.0 genes in this pathway
CARD MIR302A TARGETS	77	62	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
BRIDEAU IMPRINTED GENES	63	47	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	686	692	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-143	999	1005	1A	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-17-5p/20/93.mr/106/519.d	883	889	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-192/215	1582	1589	1A,m8	hsa-miR-192	CUGACCUAUGAAUUGACAGCC
miR-192/215	1582	1589	1A,m8	hsa-miR-215	AUGACCUAUGAAUUGACAGAC
miR-33	456	462	1A	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	456	462	1A	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-7	1063	1070	1A,m8	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RB1