SZGR2

Summary ?

GeneID	6732
Symbol	SRPK1
Synonyms	SFRSK1
Description	SRSF protein kinase 1
Reference	MIM:601939\|HGNC:HGNC:11305\|Ensembl:ENSG00000096063\|HPRD:15992\|Vega:OTTHUMG00000014583
Gene type	protein-coding
Map location	6p21.31
Pascal p-value	0.087
Sherlock p-value	0.509
Fetal beta	0.999
DMG	1 (# studies)
eGene	Cerebellar Hemisphere Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:vanEijk_2014	Genome-wide DNA methylation analysis	This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250).	1
GSMA_I	Genome scan meta-analysis	Psr: 0.033
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.04433

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg09082921	6	35744226	SRPK1	0.002	-8		DMG:vanEijk_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs9366911	chr6	36589339	SRPK1	6732		0.16		cis

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
HERC6	0.88	0.72
MX1	0.80	0.55
IFIT3	0.78	0.44
IFIT1	0.77	0.51
ATPAF1	0.75	0.73
C1QB	0.75	0.58
CD59	0.75	0.65
PPT1	0.75	0.81
AC068989.2	0.75	0.61
HSD17B12	0.74	0.78

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TMEM88	-0.41	-0.47
EGFL8	-0.40	-0.39
RP9P	-0.38	-0.53
MYLK2	-0.36	-0.40
AC005921.3	-0.36	-0.47
AC011475.1	-0.36	-0.39
SLC38A5	-0.35	-0.40
AL022328.1	-0.34	-0.46
RAMP2	-0.34	-0.44
C1orf86	-0.34	-0.30

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0000287	magnesium ion binding	IDA		11509566
GO:0005515	protein binding	IPI		10196197 \|11509566 \|17353931
GO:0005524	ATP binding	IDA		11509566
GO:0005524	ATP binding	IEA		-
GO:0004674	protein serine/threonine kinase activity	IDA		11509566
GO:0004674	protein serine/threonine kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008380	RNA splicing	TAS		8208298
GO:0006468	protein amino acid phosphorylation	IDA		11509566
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0007243	protein kinase cascade	IDA		11509566
GO:0007059	chromosome segregation	IDA		15034300
GO:0030154	cell differentiation	IEA		-
GO:0050684	regulation of mRNA processing	IDA		8208298
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IDA		11509566
GO:0005737	cytoplasm	IDA		11509566

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CROP	LUC7A \| OA48-18	cisplatin resistance-associated overexpressed protein	Biochemical Activity	BioGRID	12565863
FERMT1	C20orf42 \| DTGCU2 \| FLJ20116 \| FLJ23423 \| KIND1 \| UNC112A \| URP1	fermitin family homolog 1 (Drosophila)	-	HPRD	9472028
LBR	DHCR14B \| FLJ43126 \| LMN2R \| MGC9041 \| PHA	lamin B receptor	-	HPRD	10049757 \|10390541
MBP	MGC99675	myelin basic protein	-	HPRD	10390541
PRM1	P1	protamine 1	-	HPRD,BioGRID	10390541
RNPS1	E5.1 \| MGC117332	RNA binding protein S1, serine-rich domain	Affinity Capture-MS	BioGRID	17353931
SAFB	DKFZp779C1727 \| HAP \| HET \| SAFB1	scaffold attachment factor B	-	HPRD	11509566
SFRS1	ASF \| MGC5228 \| SF2 \| SF2p33 \| SRp30a	splicing factor, arginine/serine-rich 1	-	HPRD	8208298 \|8798720 \|9472028 \|10390541
SFRS1	ASF \| MGC5228 \| SF2 \| SF2p33 \| SRp30a	splicing factor, arginine/serine-rich 1	Affinity Capture-Western Biochemical Activity Far Western Reconstituted Complex	BioGRID	9472028 \|10196197 \|12565863 \|17517895
SFRS12	DKFZp564B176 \| MGC133045 \| SRrp508 \| SRrp86	splicing factor, arginine/serine-rich 12	-	HPRD	14559993
SFRS2IP	CASP11 \| SIP1 \| SRRP129	splicing factor, arginine/serine-rich 2, interacting protein	-	HPRD	8208298
SFRS3	SRp20	splicing factor, arginine/serine-rich 3	-	HPRD	8208298 \|10390541
SFRS4	SRP75	splicing factor, arginine/serine-rich 4	-	HPRD	8208298 \|10390541
SFRS5	HRS \| SRP40	splicing factor, arginine/serine-rich 5	-	HPRD	8208298 \|10390541
SFRS6	B52 \| FLJ08061 \| MGC5045 \| SRP55	splicing factor, arginine/serine-rich 6	-	HPRD	8208298 \|10340541
SNRNP70	RNPU1Z \| RPU1 \| SNRP70 \| U170K \| U1AP \| U1RNP	small nuclear ribonucleoprotein 70kDa (U1)	Affinity Capture-Western Biochemical Activity	BioGRID	9472028 \|12417631
U2AF1	DKFZp313J1712 \| FP793 \| RN \| RNU2AF1 \| U2AF35 \| U2AFBP	U2 small nuclear RNA auxiliary factor 1	-	HPRD	9472028
U2AF2	U2AF65	U2 small nuclear RNA auxiliary factor 2	-	HPRD	9472028
YWHAG	14-3-3GAMMA	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide	-	HPRD	15324660

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA UP	305	185	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP UP	265	158	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP	722	443	All SZGR 2.0 genes in this pathway
OUELLET OVARIAN CANCER INVASIVE VS LMP UP	117	85	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
SCHLOSSER MYC TARGETS AND SERUM RESPONSE DN	47	34	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
BENPORATH PROLIFERATION	147	80	All SZGR 2.0 genes in this pathway
SCHUHMACHER MYC TARGETS UP	80	57	All SZGR 2.0 genes in this pathway
SASAKI ADULT T CELL LEUKEMIA	176	122	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 DN	163	115	All SZGR 2.0 genes in this pathway
NUMATA CSF3 SIGNALING VIA STAT3	22	17	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS DN	371	218	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX DN	88	58	All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS DN	141	92	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
FINETTI BREAST CANCER KINOME RED	16	11	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP	973	570	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP	863	514	All SZGR 2.0 genes in this pathway
PARK APL PATHOGENESIS DN	50	35	All SZGR 2.0 genes in this pathway
SHAFFER IRF4 TARGETS IN ACTIVATED B LYMPHOCYTE	81	66	All SZGR 2.0 genes in this pathway
YAMASHITA LIVER CANCER WITH EPCAM UP	53	25	All SZGR 2.0 genes in this pathway
FOURNIER ACINAR DEVELOPMENT LATE 2	277	172	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC UP	72	53	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN	336	211	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE NOT VIA P38	337	236	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-137	1828	1835	1A,m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-139	1695	1701	1A	hsa-miR-139^brain	UCUACAGUGCACGUGUCU
miR-15/16/195/424/497	1181	1188	1A,m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-17-5p/20/93.mr/106/519.d	1104	1110	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-182	221	227	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-186	2199	2205	m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-26	1240	1246	m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	1240	1246	m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-485-5p	251	257	m8	hsa-miR-485-5p	AGAGGCUGGCCGUGAUGAAUUC
miR-503	1182	1188	1A	hsa-miR-503	UAGCAGCGGGAACAGUUCUGCAG
miR-9	223	229	1A	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA
miR-96	221	227	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SRPK1