Gene Page: ADAM17
Summary ?
| GeneID | 6868 |
| Symbol | ADAM17 |
| Synonyms | ADAM18|CD156B|CSVP|NISBD|NISBD1|TACE |
| Description | ADAM metallopeptidase domain 17 |
| Reference | MIM:603639|HGNC:HGNC:195|Ensembl:ENSG00000151694|HPRD:04703|Vega:OTTHUMG00000090425 |
| Gene type | protein-coding |
| Map location | 2p25 |
| Pascal p-value | 0.444 |
| Sherlock p-value | 0.959 |
| Fetal beta | 0.492 |
| DMG | 1 (# studies) |
| eGene | Cerebellum Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0398 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg11362955 | 2 | 9696126 | ADAM17 | 4.09E-10 | -0.014 | 7.74E-7 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MARK3 | 0.94 | 0.92 |
| TSR1 | 0.93 | 0.94 |
| FDXACB1 | 0.93 | 0.91 |
| C17orf71 | 0.93 | 0.94 |
| ZFP28 | 0.93 | 0.93 |
| RSPRY1 | 0.93 | 0.92 |
| POLR3C | 0.93 | 0.92 |
| DEM1 | 0.93 | 0.91 |
| TTLL1 | 0.93 | 0.92 |
| TRIM27 | 0.93 | 0.93 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.83 | -0.89 |
| MT-CO2 | -0.83 | -0.89 |
| AF347015.27 | -0.81 | -0.87 |
| AF347015.33 | -0.81 | -0.86 |
| MT-CYB | -0.80 | -0.87 |
| AF347015.8 | -0.79 | -0.88 |
| HLA-F | -0.78 | -0.78 |
| FXYD1 | -0.78 | -0.86 |
| AIFM3 | -0.77 | -0.78 |
| AF347015.15 | -0.77 | -0.86 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 10527948 | |
| GO:0004222 | metalloendopeptidase activity | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0017124 | SH3 domain binding | IEA | - | |
| GO:0008233 | peptidase activity | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006508 | proteolysis | IEA | - | |
| GO:0007267 | cell-cell signaling | TAS | 9034190 | |
| GO:0007219 | Notch signaling pathway | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0005887 | integral to plasma membrane | TAS | 9574564 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG NOTCH SIGNALING PATHWAY | 47 | 35 | All SZGR 2.0 genes in this pathway |
| KEGG ALZHEIMERS DISEASE | 169 | 110 | All SZGR 2.0 genes in this pathway |
| KEGG EPITHELIAL CELL SIGNALING IN HELICOBACTER PYLORI INFECTION | 68 | 44 | All SZGR 2.0 genes in this pathway |
| BIOCARTA PS1 PATHWAY | 14 | 14 | All SZGR 2.0 genes in this pathway |
| PID ERBB4 PATHWAY | 38 | 32 | All SZGR 2.0 genes in this pathway |
| PID TNF PATHWAY | 46 | 33 | All SZGR 2.0 genes in this pathway |
| PID P75 NTR PATHWAY | 69 | 51 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
| REACTOME GROWTH HORMONE RECEPTOR SIGNALING | 24 | 19 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY ERBB4 | 90 | 67 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY EGFR IN CANCER | 109 | 80 | All SZGR 2.0 genes in this pathway |
| REACTOME NUCLEAR SIGNALING BY ERBB4 | 38 | 30 | All SZGR 2.0 genes in this pathway |
| REACTOME ACTIVATED NOTCH1 TRANSMITS SIGNAL TO THE NUCLEUS | 27 | 18 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH1 | 70 | 46 | All SZGR 2.0 genes in this pathway |
| REACTOME REGULATED PROTEOLYSIS OF P75NTR | 10 | 9 | All SZGR 2.0 genes in this pathway |
| REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING | 81 | 61 | All SZGR 2.0 genes in this pathway |
| REACTOME RECEPTOR LIGAND BINDING INITIATES THE SECOND PROTEOLYTIC CLEAVAGE OF NOTCH RECEPTOR | 12 | 8 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH | 103 | 64 | All SZGR 2.0 genes in this pathway |
| REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
| REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
| NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
| ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
| UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 3 UP | 329 | 196 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| LUND SILENCED BY METHYLATION | 16 | 12 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| AMUNDSON RESPONSE TO ARSENITE | 217 | 143 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS UP | 344 | 180 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| BECKER TAMOXIFEN RESISTANCE DN | 52 | 37 | All SZGR 2.0 genes in this pathway |
| ALCALAY AML BY NPM1 LOCALIZATION UP | 140 | 83 | All SZGR 2.0 genes in this pathway |
| YAGI AML SURVIVAL | 129 | 87 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
| OUILLETTE CLL 13Q14 DELETION UP | 74 | 40 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
| PODAR RESPONSE TO ADAPHOSTIN UP | 147 | 98 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
| CHANDRAN METASTASIS UP | 221 | 135 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| PHONG TNF RESPONSE VIA P38 COMPLETE | 227 | 151 | All SZGR 2.0 genes in this pathway |
| ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
| NABA ECM REGULATORS | 238 | 125 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-145 | 417 | 424 | 1A,m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
| miR-338 | 108 | 114 | m8 | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
| miR-544 | 261 | 267 | 1A | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.