SZGR2

Summary ?

GeneID	7407
Symbol	VARS
Synonyms	G7A\|VARS1\|VARS2
Description	valyl-tRNA synthetase
Reference	MIM:192150\|HGNC:HGNC:12651\|Ensembl:ENSG00000204394\|HPRD:10362\|Vega:OTTHUMG00000031286
Gene type	protein-coding
Map location	6p21.3
Pascal p-value	1E-12
Fetal beta	0.611
eGene	Meta
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.033
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0113

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SLCO2B1	0.83	0.84
MMRN2	0.83	0.87
A2M	0.78	0.79
ITIH5	0.77	0.83
TNFRSF1B	0.77	0.78
CDH5	0.74	0.80
BGN	0.74	0.76
ENG	0.74	0.80
CLEC14A	0.74	0.75
LRRC32	0.73	0.80

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ZNF32	-0.52	-0.58
C8orf59	-0.51	-0.59
SNHG12	-0.51	-0.56
OXSM	-0.50	-0.57
NDUFAF2	-0.50	-0.56
C12orf45	-0.49	-0.58
ST20	-0.49	-0.55
MTIF3	-0.47	-0.52
ATP5E	-0.47	-0.60
MRPL21	-0.46	-0.52

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005515	protein binding	IPI		17353931
GO:0005524	ATP binding	IEA		-
GO:0004832	valine-tRNA ligase activity	IDA		8428657
GO:0004832	valine-tRNA ligase activity	IEA		-
GO:0016874	ligase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006414	translational elongation	NAS		-
GO:0006438	valyl-tRNA aminoacylation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	NAS		-
GO:0005737	cytoplasm	IEA		-
GO:0005739	mitochondrion	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
EEF1A1	CCS-3 \| CCS3 \| EEF-1 \| EEF1A \| EF-Tu \| EF1A \| FLJ25721 \| GRAF-1EF \| HNGC:16303 \| LENG7 \| MGC102687 \| MGC131894 \| MGC16224 \| PTI1 \| eEF1A-1	eukaryotic translation elongation factor 1 alpha 1	-	HPRD,BioGRID	2556394 \|3169261
EEF1A2	EEF1AL \| EF-1-alpha-2 \| EF1A \| FLJ41696 \| HS1 \| STN \| STNL	eukaryotic translation elongation factor 1 alpha 2	Affinity Capture-MS	BioGRID	17353931
EEF1B2	EEF1B \| EEF1B1 \| EF1B	eukaryotic translation elongation factor 1 beta 2	-	HPRD,BioGRID	2556394 \|3169261
EEF1D	EF-1D \| EF1D \| FLJ20897 \| FP1047	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)	-	HPRD	2556394 \|3169261
EEF1D	EF-1D \| EF1D \| FLJ20897 \| FP1047	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)	-	HPRD,BioGRID	2556394 \|3169261\|8294461
EEF1G	EF1G \| GIG35	eukaryotic translation elongation factor 1 gamma	Co-purification	BioGRID	3169261
EPB41	4.1R \| EL1 \| HE	erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)	Affinity Capture-MS	BioGRID	17353931
GFM1	COXPD1 \| EFG \| EFG1 \| EFGM \| EGF1 \| FLJ12662 \| FLJ13632 \| FLJ20773 \| GFM \| hEFG1	G elongation factor, mitochondrial 1	-	HPRD	2556394 \|3169261
HLA-B	AS \| HLA-B-7301 \| HLA-B73 \| HLAB \| HLAC \| SPDA1	major histocompatibility complex, class I, B	Affinity Capture-MS	BioGRID	17353931
IKBKG	AMCBX1 \| FIP-3 \| FIP3 \| Fip3p \| IKK-gamma \| IP \| IP1 \| IP2 \| IPD2 \| NEMO	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma	-	HPRD	14743216
TFE3	RCCP2 \| TFEA \| bHLHe33	transcription factor binding to IGHM enhancer 3	Affinity Capture-MS	BioGRID	17353931
TRAF6	MGC:3310 \| RNF85	TNF receptor-associated factor 6	Affinity Capture-MS	BioGRID	17353931

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG VALINE LEUCINE AND ISOLEUCINE BIOSYNTHESIS	11	8	All SZGR 2.0 genes in this pathway
KEGG AMINOACYL TRNA BIOSYNTHESIS	41	33	All SZGR 2.0 genes in this pathway
REACTOME CYTOSOLIC TRNA AMINOACYLATION	24	19	All SZGR 2.0 genes in this pathway
REACTOME TRNA AMINOACYLATION	42	34	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP	368	234	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN	335	193	All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS UP	194	112	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP	536	340	All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP	207	128	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
CEBALLOS TARGETS OF TP53 AND MYC DN	38	31	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE DN	121	79	All SZGR 2.0 genes in this pathway
MANALO HYPOXIA DN	289	166	All SZGR 2.0 genes in this pathway
SCHUHMACHER MYC TARGETS UP	80	57	All SZGR 2.0 genes in this pathway
KLEIN PRIMARY EFFUSION LYMPHOMA UP	51	29	All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION DN	337	230	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD UP	222	139	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP	487	303	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX DN	88	58	All SZGR 2.0 genes in this pathway
ABE VEGFA TARGETS 30MIN	29	21	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
SANSOM APC MYC TARGETS	217	138	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS REQUIRE MYC	210	123	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS DN	292	189	All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS	425	261	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR DN	277	166	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC UP	72	53	All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN	253	192	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14	143	86	All SZGR 2.0 genes in this pathway
KYNG RESPONSE TO H2O2 VIA ERCC6 UP	40	30	All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP	194	133	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP	570	339	All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES	462	273	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-137	52	58	1A	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: VARS