Gene Page: ADAM12
Summary ?
GeneID | 8038 |
Symbol | ADAM12 |
Synonyms | ADAM12-OT1|CAR10|MCMP|MCMPMltna|MLTN|MLTNA |
Description | ADAM metallopeptidase domain 12 |
Reference | MIM:602714|HGNC:HGNC:190|Ensembl:ENSG00000148848|HPRD:04092|Vega:OTTHUMG00000019243 |
Gene type | protein-coding |
Map location | 10q26 |
Pascal p-value | 0.016 |
Fetal beta | 0.517 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03487 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10994209 | chr10 | 61877705 | ADAM12 | 8038 | 0.14 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
BXDC2 | 0.92 | 0.91 |
YWHAE | 0.91 | 0.90 |
OLA1 | 0.90 | 0.88 |
C11orf58 | 0.90 | 0.90 |
DNAJC8 | 0.90 | 0.87 |
TXNL1 | 0.90 | 0.89 |
COPS3 | 0.89 | 0.90 |
MMADHC | 0.89 | 0.92 |
TAF7 | 0.89 | 0.89 |
C7orf38 | 0.89 | 0.88 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.2 | -0.66 | -0.75 |
MT-CYB | -0.65 | -0.73 |
MT-CO2 | -0.65 | -0.71 |
AF347015.33 | -0.65 | -0.73 |
AF347015.26 | -0.65 | -0.75 |
AF347015.15 | -0.64 | -0.73 |
HLA-F | -0.64 | -0.70 |
AF347015.8 | -0.63 | -0.71 |
AF347015.31 | -0.62 | -0.69 |
AF347015.9 | -0.62 | -0.72 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
GO:0004222 | metalloendopeptidase activity | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0017124 | SH3 domain binding | IEA | - | |
GO:0008233 | peptidase activity | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007155 | cell adhesion | IEA | - | |
GO:0006508 | proteolysis | IEA | - | |
GO:0007520 | myoblast fusion | TAS | 7566181 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | TAS | 7566181 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
BIOCARTA CARDIACEGF PATHWAY | 18 | 16 | All SZGR 2.0 genes in this pathway |
PID NOTCH PATHWAY | 59 | 49 | All SZGR 2.0 genes in this pathway |
PID INTEGRIN A9B1 PATHWAY | 25 | 18 | All SZGR 2.0 genes in this pathway |
PID SYNDECAN 4 PATHWAY | 32 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY EGFR IN CANCER | 109 | 80 | All SZGR 2.0 genes in this pathway |
LU TUMOR VASCULATURE UP | 29 | 17 | All SZGR 2.0 genes in this pathway |
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN | 169 | 118 | All SZGR 2.0 genes in this pathway |
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP | 351 | 230 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST LOBULAR CARCINOMA VS DUCTAL NORMAL UP | 69 | 38 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST LOBULAR CARCINOMA VS LOBULAR NORMAL DN | 74 | 42 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER ADVANCED VS EARLY UP | 175 | 120 | All SZGR 2.0 genes in this pathway |
JAEGER METASTASIS UP | 44 | 23 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP | 276 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS B UP | 26 | 16 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
DUNNE TARGETS OF AML1 MTG8 FUSION DN | 19 | 17 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
ROVERSI GLIOMA COPY NUMBER DN | 54 | 37 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED MODERATELY VS POORLY UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
WEBER METHYLATED IN COLON CANCER | 18 | 13 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
NIELSEN GIST VS SYNOVIAL SARCOMA UP | 19 | 12 | All SZGR 2.0 genes in this pathway |
LINDVALL IMMORTALIZED BY TERT DN | 80 | 56 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 5 | 126 | 78 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
SU PLACENTA | 30 | 18 | All SZGR 2.0 genes in this pathway |
DURCHDEWALD SKIN CARCINOGENESIS DN | 264 | 168 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY UV | 62 | 43 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR DN | 191 | 123 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
LU TUMOR ENDOTHELIAL MARKERS UP | 22 | 14 | All SZGR 2.0 genes in this pathway |
WANG NEOPLASTIC TRANSFORMATION BY CCND1 MYC | 21 | 14 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN | 245 | 150 | All SZGR 2.0 genes in this pathway |
POOLA INVASIVE BREAST CANCER UP | 288 | 168 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA MESENCHYMAL | 216 | 130 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR UP | 199 | 143 | All SZGR 2.0 genes in this pathway |
ANASTASSIOU CANCER MESENCHYMAL TRANSITION SIGNATURE | 64 | 40 | All SZGR 2.0 genes in this pathway |
DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
NABA ECM REGULATORS | 238 | 125 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER CLUSTER 4 | 19 | 12 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-130/301 | 38 | 45 | 1A,m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-19 | 37 | 43 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-26 | 306 | 312 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-29 | 159 | 165 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.