Gene Page: PKP4
Summary ?
GeneID | 8502 |
Symbol | PKP4 |
Synonyms | p0071 |
Description | plakophilin 4 |
Reference | MIM:604276|HGNC:HGNC:9026|Ensembl:ENSG00000144283|HPRD:05043|Vega:OTTHUMG00000153969 |
Gene type | protein-coding |
Map location | 2q24.1 |
Pascal p-value | 0.007 |
Sherlock p-value | 0.066 |
eGene | Myers' cis & trans |
Support | CELL ADHESION AND TRANSSYNAPTIC SIGNALING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs2141326 | chr2 | 28779227 | PKP4 | 8502 | 0.08 | trans | ||
rs871872 | chr2 | 28782263 | PKP4 | 8502 | 0.06 | trans | ||
rs1733504 | chr3 | 71372796 | PKP4 | 8502 | 0.01 | trans | ||
rs1290499 | chr3 | 71393339 | PKP4 | 8502 | 0.15 | trans | ||
rs1295400 | chr7 | 51138813 | PKP4 | 8502 | 0.01 | trans | ||
rs758167 | chr12 | 1915558 | PKP4 | 8502 | 0.07 | trans | ||
rs10144695 | chr14 | 49442442 | PKP4 | 8502 | 0.19 | trans | ||
rs6518060 | chr21 | 22427853 | PKP4 | 8502 | 0.17 | trans | ||
rs9983417 | chr21 | 22431220 | PKP4 | 8502 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ANAPC2 | 0.93 | 0.93 |
BRF1 | 0.92 | 0.94 |
AC011498.3 | 0.92 | 0.93 |
SF4 | 0.92 | 0.92 |
CCDC137 | 0.91 | 0.92 |
OGFR | 0.91 | 0.91 |
PPAN | 0.90 | 0.90 |
PELP1 | 0.90 | 0.91 |
ATAD3A | 0.90 | 0.92 |
ZNF653 | 0.89 | 0.91 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.80 | -0.82 |
MT-CO2 | -0.79 | -0.81 |
AF347015.33 | -0.77 | -0.78 |
MT-CYB | -0.76 | -0.79 |
AF347015.27 | -0.76 | -0.80 |
AF347015.21 | -0.76 | -0.82 |
AF347015.8 | -0.75 | -0.80 |
AF347015.2 | -0.73 | -0.77 |
AF347015.15 | -0.73 | -0.78 |
HIGD1B | -0.72 | -0.75 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005488 | binding | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0005198 | structural molecule activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007155 | cell adhesion | NAS | 8937994 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005911 | cell-cell junction | TAS | 8937994 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP | 233 | 161 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN | 275 | 168 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
DAWSON METHYLATED IN LYMPHOMA TCL1 | 59 | 45 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
WEI MIR34A TARGETS | 148 | 97 | All SZGR 2.0 genes in this pathway |
LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP | 236 | 139 | All SZGR 2.0 genes in this pathway |
RICKMAN METASTASIS UP | 344 | 180 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA UP | 98 | 64 | All SZGR 2.0 genes in this pathway |
PAL PRMT5 TARGETS UP | 203 | 135 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D5 | 39 | 26 | All SZGR 2.0 genes in this pathway |
GAJATE RESPONSE TO TRABECTEDIN DN | 19 | 11 | All SZGR 2.0 genes in this pathway |
GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
KEEN RESPONSE TO ROSIGLITAZONE DN | 106 | 68 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P3 | 160 | 103 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL DN | 216 | 143 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A5 | 70 | 32 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA | 43 | 27 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS UP | 74 | 45 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 9 | 76 | 45 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
VANOEVELEN MYOGENESIS SIN3A TARGETS | 220 | 133 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-125/351 | 150 | 156 | 1A | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-150 | 170 | 177 | 1A,m8 | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
miR-183 | 481 | 487 | m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-192/215 | 298 | 305 | 1A,m8 | hsa-miR-192 | CUGACCUAUGAAUUGACAGCC |
hsa-miR-215 | AUGACCUAUGAAUUGACAGAC | ||||
miR-218 | 629 | 636 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-23 | 329 | 336 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 328 | 335 | 1A,m8 | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-34/449 | 694 | 701 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.