Gene Page: GOSR1
Summary ?
GeneID | 9527 |
Symbol | GOSR1 |
Synonyms | GOLIM2|GOS-28|GOS28|GOS28/P28|GS28|P28 |
Description | golgi SNAP receptor complex member 1 |
Reference | MIM:604026|HGNC:HGNC:4430|Ensembl:ENSG00000108587|Vega:OTTHUMG00000132796 |
Gene type | protein-coding |
Map location | 17q11 |
Pascal p-value | 2.499E-4 |
Sherlock p-value | 0.533 |
eGene | Anterior cingulate cortex BA24 Caudate basal ganglia Cortex Frontal Cortex BA9 Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs16965255 | chr17 | 28182193 | GOSR1 | 9527 | 0.13 | cis | ||
rs3764417 | 17 | 28705043 | GOSR1 | ENSG00000108587.10 | 1.726E-6 | 0.01 | -99337 | gtex_brain_ba24 |
rs7220213 | 17 | 28709055 | GOSR1 | ENSG00000108587.10 | 1.726E-6 | 0.01 | -95325 | gtex_brain_ba24 |
rs7222059 | 17 | 28709426 | GOSR1 | ENSG00000108587.10 | 1.726E-6 | 0.01 | -94954 | gtex_brain_ba24 |
rs4794871 | 17 | 28713789 | GOSR1 | ENSG00000108587.10 | 1.726E-6 | 0.01 | -90591 | gtex_brain_ba24 |
rs7209857 | 17 | 28728401 | GOSR1 | ENSG00000108587.10 | 1.856E-6 | 0.01 | -75979 | gtex_brain_ba24 |
rs6505185 | 17 | 28734413 | GOSR1 | ENSG00000108587.10 | 1.867E-6 | 0.01 | -69967 | gtex_brain_ba24 |
rs2191351 | 17 | 28759035 | GOSR1 | ENSG00000108587.10 | 1.726E-6 | 0.01 | -45345 | gtex_brain_ba24 |
rs758722 | 17 | 28771495 | GOSR1 | ENSG00000108587.10 | 1.728E-6 | 0.01 | -32885 | gtex_brain_ba24 |
rs4795553 | 17 | 28777324 | GOSR1 | ENSG00000108587.10 | 1.726E-6 | 0.01 | -27056 | gtex_brain_ba24 |
rs2253256 | 17 | 28778720 | GOSR1 | ENSG00000108587.10 | 1.726E-6 | 0.01 | -25660 | gtex_brain_ba24 |
rs6505188 | 17 | 28784382 | GOSR1 | ENSG00000108587.10 | 1.726E-6 | 0.01 | -19998 | gtex_brain_ba24 |
rs9406 | 17 | 28794020 | GOSR1 | ENSG00000108587.10 | 1.726E-6 | 0.01 | -10360 | gtex_brain_ba24 |
rs11080127 | 17 | 28797497 | GOSR1 | ENSG00000108587.10 | 1.832E-6 | 0.01 | -6883 | gtex_brain_ba24 |
rs6505189 | 17 | 28801076 | GOSR1 | ENSG00000108587.10 | 7.006E-7 | 0.01 | -3304 | gtex_brain_ba24 |
rs8072409 | 17 | 28802359 | GOSR1 | ENSG00000108587.10 | 1.726E-6 | 0.01 | -2021 | gtex_brain_ba24 |
rs4795554 | 17 | 28804996 | GOSR1 | ENSG00000108587.10 | 1.726E-6 | 0.01 | 616 | gtex_brain_ba24 |
rs7223819 | 17 | 28814674 | GOSR1 | ENSG00000108587.10 | 1.071E-6 | 0.01 | 10294 | gtex_brain_ba24 |
rs9896063 | 17 | 28815428 | GOSR1 | ENSG00000108587.10 | 8.912E-7 | 0.01 | 11048 | gtex_brain_ba24 |
rs7212107 | 17 | 28820047 | GOSR1 | ENSG00000108587.10 | 8.135E-7 | 0.01 | 15667 | gtex_brain_ba24 |
rs7218912 | 17 | 28821826 | GOSR1 | ENSG00000108587.10 | 1.059E-6 | 0.01 | 17446 | gtex_brain_ba24 |
rs2321857 | 17 | 28826560 | GOSR1 | ENSG00000108587.10 | 1.369E-6 | 0.01 | 22180 | gtex_brain_ba24 |
rs9896343 | 17 | 28831253 | GOSR1 | ENSG00000108587.10 | 1.071E-6 | 0.01 | 26873 | gtex_brain_ba24 |
rs1434688 | 17 | 28840397 | GOSR1 | ENSG00000108587.10 | 1.073E-6 | 0.01 | 36017 | gtex_brain_ba24 |
rs6505191 | 17 | 28843030 | GOSR1 | ENSG00000108587.10 | 1.071E-6 | 0.01 | 38650 | gtex_brain_ba24 |
rs9900343 | 17 | 28843190 | GOSR1 | ENSG00000108587.10 | 1.071E-6 | 0.01 | 38810 | gtex_brain_ba24 |
rs9895966 | 17 | 28846054 | GOSR1 | ENSG00000108587.10 | 8.199E-7 | 0.01 | 41674 | gtex_brain_ba24 |
rs12944483 | 17 | 28846162 | GOSR1 | ENSG00000108587.10 | 1.071E-6 | 0.01 | 41782 | gtex_brain_ba24 |
rs82390 | 17 | 28860333 | GOSR1 | ENSG00000108587.10 | 1.072E-6 | 0.01 | 55953 | gtex_brain_ba24 |
rs216472 | 17 | 28864382 | GOSR1 | ENSG00000108587.10 | 1.071E-6 | 0.01 | 60002 | gtex_brain_ba24 |
rs216473 | 17 | 28864910 | GOSR1 | ENSG00000108587.10 | 4.393E-6 | 0.01 | 60530 | gtex_brain_ba24 |
rs428725 | 17 | 28865900 | GOSR1 | ENSG00000108587.10 | 1.067E-6 | 0.01 | 61520 | gtex_brain_ba24 |
rs216475 | 17 | 28865969 | GOSR1 | ENSG00000108587.10 | 1.071E-6 | 0.01 | 61589 | gtex_brain_ba24 |
rs216476 | 17 | 28866646 | GOSR1 | ENSG00000108587.10 | 1.071E-6 | 0.01 | 62266 | gtex_brain_ba24 |
rs216484 | 17 | 28871175 | GOSR1 | ENSG00000108587.10 | 1.071E-6 | 0.01 | 66795 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
STIM1 | 0.84 | 0.88 |
AC105206.1 | 0.84 | 0.91 |
MAP2K1 | 0.83 | 0.89 |
NPTN | 0.83 | 0.88 |
RP5-1187M17.1 | 0.83 | 0.88 |
ACTN1 | 0.83 | 0.83 |
RASGEF1A | 0.83 | 0.89 |
C2orf55 | 0.83 | 0.82 |
SLC35F3 | 0.82 | 0.87 |
NCDN | 0.82 | 0.83 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
BCL7C | -0.43 | -0.53 |
HEBP2 | -0.40 | -0.55 |
KIAA1949 | -0.40 | -0.28 |
TUBB2B | -0.39 | -0.39 |
TRAF4 | -0.39 | -0.43 |
SH2B2 | -0.38 | -0.41 |
FABP7 | -0.38 | -0.47 |
AF186192.1 | -0.38 | -0.27 |
RBMX2 | -0.38 | -0.42 |
FADS2 | -0.38 | -0.32 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005484 | SNAP receptor activity | IDA | 15215310 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006886 | intracellular protein transport | IEA | - | |
GO:0006891 | intra-Golgi vesicle-mediated transport | TAS | 8636227 | |
GO:0016192 | vesicle-mediated transport | IEA | - | |
GO:0042147 | retrograde transport, endosome to Golgi | IDA | 15215310 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0031201 | SNARE complex | TAS | neuron, Synap (GO term level: 6) | 15215310 |
GO:0000139 | Golgi membrane | IEA | - | |
GO:0005794 | Golgi apparatus | IDA | 15215310 | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
BET1 | DKFZp781C0425 | HBET1 | blocked early in transport 1 homolog (S. cerevisiae) | Affinity Capture-Western | BioGRID | 11927603 |
BET1L | BET1L1 | GOLIM3 | GS15 | HSPC197 | blocked early in transport 1 homolog (S. cerevisiae)-like | Affinity Capture-Western | BioGRID | 11927603 |12388752 |
EBI3 | IL27B | Epstein-Barr virus induced 3 | - | HPRD,BioGRID | 12121660 |
GABARAPL2 | ATG8 | GATE-16 | GATE16 | GEF-2 | GEF2 | GABA(A) receptor-associated protein-like 2 | - | HPRD | 10747018 |
IL27RA | CRL1 | IL27R | TCCR | WSX1 | zcytor1 | interleukin 27 receptor, alpha | Affinity Capture-Western | BioGRID | 12121660 |
NAPA | SNAPA | N-ethylmaleimide-sensitive factor attachment protein, alpha | - | HPRD | 9325254 |
NSF | SKD2 | N-ethylmaleimide-sensitive factor | - | HPRD | 8636227 |9325254 |
SNAP25 | FLJ23079 | RIC-4 | RIC4 | SEC9 | SNAP | SNAP-25 | bA416N4.2 | dJ1068F16.2 | synaptosomal-associated protein, 25kDa | Reconstituted Complex | BioGRID | 9325254 |
STX5 | SED5 | STX5A | syntaxin 5 | - | HPRD,BioGRID | 9094723 |
USO1 | P115 | TAP | VDP | USO1 homolog, vesicle docking protein (yeast) | Co-purification Reconstituted Complex | BioGRID | 11927603 |
YKT6 | - | YKT6 v-SNARE homolog (S. cerevisiae) | Affinity Capture-Western | BioGRID | 11927603 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG SNARE INTERACTIONS IN VESICULAR TRANSPORT | 38 | 25 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 DN | 267 | 178 | All SZGR 2.0 genes in this pathway |
ZHONG RESPONSE TO AZACITIDINE AND TSA DN | 70 | 38 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER DN | 406 | 230 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER UP | 181 | 108 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 17Q11 Q21 AMPLICON | 133 | 78 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
NOUZOVA TRETINOIN AND H4 ACETYLATION | 143 | 85 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
JI RESPONSE TO FSH UP | 74 | 56 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE UP | 156 | 92 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS UP | 170 | 107 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING | 246 | 152 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
ALFANO MYC TARGETS | 239 | 156 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-17-5p/20/93.mr/106/519.d | 4285 | 4291 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-9 | 372 | 378 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.