SZGR2

Summary ?

GeneID	9647
Symbol	PPM1F
Synonyms	CAMKP\|CaMKPase\|FEM-2\|POPX2\|hFEM-2
Description	protein phosphatase, Mg2+/Mn2+ dependent 1F
Reference	HGNC:HGNC:19388\|Ensembl:ENSG00000100034\|HPRD:10163\|Vega:OTTHUMG00000150835
Gene type	protein-coding
Map location	22q11.22
Pascal p-value	0.01
Sherlock p-value	0.768
Fetal beta	1.047
eGene	Cerebellar Hemisphere Cerebellum Putamen basal ganglia Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_I	Genome scan meta-analysis	Psr: 0.031

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs17542473	chr4	111182451	PPM1F	9647		0.08		trans
rs56094396	22	22278727	PPM1F	ENSG00000100034.9	2.128E-7	0.01	28482	gtex_brain_putamen_basal
rs738858	22	22280917	PPM1F	ENSG00000100034.9	5.633E-7	0.01	26292	gtex_brain_putamen_basal
rs240064	22	22281638	PPM1F	ENSG00000100034.9	1.277E-6	0.01	25571	gtex_brain_putamen_basal
rs2329884	22	22282263	PPM1F	ENSG00000100034.9	4.729E-7	0.01	24946	gtex_brain_putamen_basal
rs894095	22	22282776	PPM1F	ENSG00000100034.9	4.729E-7	0.01	24433	gtex_brain_putamen_basal
.	22	22283231	PPM1F	ENSG00000100034.9	9.157E-7	0.01	23978	gtex_brain_putamen_basal
rs33940969	22	22283232	PPM1F	ENSG00000100034.9	9.684E-7	0.01	23977	gtex_brain_putamen_basal
rs2083565	22	22284357	PPM1F	ENSG00000100034.9	4.729E-7	0.01	22852	gtex_brain_putamen_basal
rs5995257	22	22285987	PPM1F	ENSG00000100034.9	4.409E-7	0.01	21222	gtex_brain_putamen_basal
rs2027790	22	22287964	PPM1F	ENSG00000100034.9	3.39E-7	0.01	19245	gtex_brain_putamen_basal
rs94194	22	22288309	PPM1F	ENSG00000100034.9	3.241E-6	0.01	18900	gtex_brain_putamen_basal
rs5995268	22	22289031	PPM1F	ENSG00000100034.9	5.041E-7	0.01	18178	gtex_brain_putamen_basal
rs5995269	22	22289397	PPM1F	ENSG00000100034.9	7.673E-7	0.01	17812	gtex_brain_putamen_basal
rs240066	22	22292995	PPM1F	ENSG00000100034.9	1.874E-6	0.01	14214	gtex_brain_putamen_basal
rs5756181	22	22305008	PPM1F	ENSG00000100034.9	2.034E-6	0.01	2201	gtex_brain_putamen_basal
rs381849	22	22305713	PPM1F	ENSG00000100034.9	2.513E-6	0.01	1496	gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
EIF4B	0.93	0.92
IGBP1	0.92	0.88
INTS7	0.91	0.92
COMMD2	0.91	0.89
ARG2	0.90	0.91
KARS	0.90	0.92
CCT3	0.90	0.89
POLR1E	0.90	0.90
EEF2	0.90	0.89
TEX10	0.90	0.91

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MT-CO2	-0.65	-0.86
AF347015.31	-0.65	-0.85
AF347015.33	-0.65	-0.85
FXYD1	-0.64	-0.87
C5orf53	-0.64	-0.77
HLA-F	-0.63	-0.78
AF347015.27	-0.63	-0.84
IFI27	-0.63	-0.85
HEPN1	-0.63	-0.77
MT-CYB	-0.63	-0.83

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000287	magnesium ion binding	IEA		-
GO:0004722	protein serine/threonine phosphatase activity	IEA		-
GO:0016787	hydrolase activity	IEA		-
GO:0030145	manganese ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006470	protein amino acid dephosphorylation	IEA		-
GO:0006915	apoptosis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008287	protein serine/threonine phosphatase complex	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
HOLLMANN APOPTOSIS VIA CD40 DN	267	178	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN	126	86	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 2 DN	77	46	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN	162	116	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
PATTERSON DOCETAXEL RESISTANCE	29	20	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
DAIRKEE TERT TARGETS UP	380	213	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 UP	209	139	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN	637	377	All SZGR 2.0 genes in this pathway
LIAO METASTASIS	539	324	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY UP	86	48	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
GEORGANTAS HSC MARKERS	71	47	All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS DN	141	92	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP	393	244	All SZGR 2.0 genes in this pathway
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN	354	216	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C CLUSTER UP	38	26	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C UP	47	29	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO CSF2RB AND IL4 DN	315	201	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF DN	235	144	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN	245	150	All SZGR 2.0 genes in this pathway
ZEMBUTSU SENSITIVITY TO CISPLATIN	20	14	All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS DN	213	127	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE	317	190	All SZGR 2.0 genes in this pathway
CERIBELLI GENES INACTIVE AND BOUND BY NFY	45	27	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE	227	151	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	942	948	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	941	948	1A,m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	941	948	1A,m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-149	1944	1950	m8	hsa-miR-149^brain	UCUGGCUCCGUGUCUUCACUCC
miR-200bc/429	719	725	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
				hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-217	864	870	1A	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-299-5p	3650	3656	1A	hsa-miR-299-5p	UGGUUUACCGUCCCACAUACAU
miR-342	2753	2759	m8	hsa-miR-342^brain	UCUCACACAGAAAUCGCACCCGUC
miR-377	2752	2758	m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-96	750	756	m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PPM1F