SZGR2

Summary ?

GeneID	1019
Symbol	CDK4
Synonyms	CMM3\|PSK-J3
Description	cyclin-dependent kinase 4
Reference	MIM:123829\|HGNC:HGNC:1773\|Ensembl:ENSG00000135446\|HPRD:00447\|Vega:OTTHUMG00000170382
Gene type	protein-coding
Map location	12q14
Pascal p-value	0.601
Sherlock p-value	0.833
Fetal beta	1.769
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1875

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg22715954	12	58146426	CDK4	9.25E-9	-0.022	4.15E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TUBGCP6	0.92	0.94
WDR59	0.90	0.91
RHOT2	0.89	0.88
LZTR1	0.89	0.91
SH2B1	0.88	0.91
NDST2	0.88	0.90
COG7	0.88	0.90
ZSWIM1	0.88	0.89
ANKS3	0.88	0.90
ABCC10	0.87	0.91

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.72	-0.78
AF347015.31	-0.71	-0.73
AF347015.27	-0.70	-0.72
MT-CO2	-0.69	-0.71
AF347015.8	-0.68	-0.70
MT-CYB	-0.67	-0.68
AF347015.33	-0.65	-0.66
AF347015.15	-0.64	-0.66
MT-ATP8	-0.62	-0.73
AF347015.2	-0.62	-0.64

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004693	cyclin-dependent protein kinase activity	IEA	neuron (GO term level: 8)	-
GO:0000166	nucleotide binding	IEA		-
GO:0005515	protein binding	IPI		9106657 \|11896535 \|15232106 \|15558030 \|16169070 \|17274640 \|17353931 \|17909018
GO:0005524	ATP binding	IEA		-
GO:0004672	protein kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000082	G1/S transition of mitotic cell cycle	IMP		7603984
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0007165	signal transduction	IEA		-
GO:0010468	regulation of gene expression	IMP		17420273
GO:0051301	cell division	IEA		-
GO:0048146	positive regulation of fibroblast proliferation	IMP		17420273
GO:0051726	regulation of cell cycle	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000307	cyclin-dependent protein kinase holoenzyme complex	IEA		-
GO:0005829	cytosol	EXP		9106657
GO:0005634	nucleus	IDA		16109376
GO:0005654	nucleoplasm	EXP		9190208 \|16782892
GO:0005667	transcription factor complex	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTR3B	ARP11 \| ARP3BETA \| DKFZp686O24114	ARP3 actin-related protein 3 homolog B (yeast)	Affinity Capture-MS	BioGRID	17353931
BAT3	BAG-6 \| BAG6 \| D6S52E \| G3	HLA-B associated transcript 3	Two-hybrid	BioGRID	16169070
BIRC5	API4 \| EPR-1	baculoviral IAP repeat-containing 5	-	HPRD,BioGRID	10713676
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	-	HPRD,BioGRID	9244350
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	BRCA1 associates with CDK4	BIND	9244350
CAPNS1	30K \| CALPAIN4 \| CANP \| CANPS \| CAPN4 \| CDPS	calpain, small subunit 1	Two-hybrid	BioGRID	16169070
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	-	HPRD	9150368 \|9837900
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	CDK4 interacts with Cyclin D1. This interaction was modelled on a demonstrated interaction between human CDK4 and Cyclin D1 from an unspecified species.	BIND	9228064
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	CCND1 (cyclin D1) interacts with CDK4.	BIND	8662825
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	Affinity Capture-Western Reconstituted Complex	BioGRID	8259215 \|9837900 \|10580009 \|11360184
CCND2	KIAK0002 \| MGC102758	cyclin D2	CCND2 interacts with CDK4	BIND	11291051
CCND2	KIAK0002 \| MGC102758	cyclin D2	-	HPRD,BioGRID	11358847
CCND3	-	cyclin D3	-	HPRD,BioGRID	10342870
CDC37	P50CDC37	cell division cycle 37 homolog (S. cerevisiae)	-	HPRD,BioGRID	8666233 \|8703009
CDC7	CDC7L1 \| HsCDC7 \| Hsk1 \| MGC117361 \| MGC126237 \| MGC126238 \| huCDC7	cell division cycle 7 homolog (S. cerevisiae)	-	HPRD	15232106
CDKN1A	CAP20 \| CDKN1 \| CIP1 \| MDA-6 \| P21 \| SDI1 \| WAF1 \| p21CIP1	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	Cdk4 interacts with p21.	BIND	8999999
CDKN1B	CDKN4 \| KIP1 \| MEN1B \| MEN4 \| P27KIP1	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	-	HPRD,BioGRID	10908655
CDKN2A	ARF \| CDK4I \| CDKN2 \| CMM2 \| INK4 \| INK4a \| MLM \| MTS1 \| TP16 \| p14 \| p14ARF \| p16 \| p16INK4 \| p16INK4a \| p19	cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	p16 interacts with cdk4. This interaction was modeled on a demonstrated interaction between human p16 and cdk4 from an unspecified species.	BIND	9482104
CDKN2A	ARF \| CDK4I \| CDKN2 \| CMM2 \| INK4 \| INK4a \| MLM \| MTS1 \| TP16 \| p14 \| p14ARF \| p16 \| p16INK4 \| p16INK4a \| p19	cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	CDKN2A interacts with CDK4	BIND	11556834
CDKN2A	ARF \| CDK4I \| CDKN2 \| CMM2 \| INK4 \| INK4a \| MLM \| MTS1 \| TP16 \| p14 \| p14ARF \| p16 \| p16INK4 \| p16INK4a \| p19	cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	-	HPRD,BioGRID	9228064
CDKN2A	ARF \| CDK4I \| CDKN2 \| CMM2 \| INK4 \| INK4a \| MLM \| MTS1 \| TP16 \| p14 \| p14ARF \| p16 \| p16INK4 \| p16INK4a \| p19	cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	-	HPRD	9228064 \|15232106
CDKN2A	ARF \| CDK4I \| CDKN2 \| CMM2 \| INK4 \| INK4a \| MLM \| MTS1 \| TP16 \| p14 \| p14ARF \| p16 \| p16INK4 \| p16INK4a \| p19	cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	p16 interacts with CDK4. This interaction was modeled on a demonstrated interaction between human p16 and CDK4 from an unspecified species.	BIND	10491434
CDKN2A	ARF \| CDK4I \| CDKN2 \| CMM2 \| INK4 \| INK4a \| MLM \| MTS1 \| TP16 \| p14 \| p14ARF \| p16 \| p16INK4 \| p16INK4a \| p19	cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	p16 interacts with cdk4.	BIND	8805225
CDKN2B	CDK4I \| INK4B \| MTS2 \| P15 \| TP15 \| p15INK4b	cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)	-	HPRD	7478582 \|9111314 \|9163429
CDKN2B	CDK4I \| INK4B \| MTS2 \| P15 \| TP15 \| p15INK4b	cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)	in vitro in vivo Two-hybrid	BioGRID	9163429 \|16169070 \|16189514
CDKN2C	INK4C \| p18 \| p18-INK4C	cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)	-	HPRD,BioGRID	8001816
CDKN2C	INK4C \| p18 \| p18-INK4C	cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)	An unspecified isoform of p18 interacts with cdk4. This interaction was modeled on a demonstrated interaction between human p18 and cdk4 from an unspecified species.	BIND	9482104
CDKN2D	INK4D \| p19 \| p19-INK4D	cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)	Two-hybrid	BioGRID	16189514
CEBPA	C/EBP-alpha \| CEBP	CCAAT/enhancer binding protein (C/EBP), alpha	-	HPRD,BioGRID	11684017
CNOT7	CAF1 \| hCAF-1	CCR4-NOT transcription complex, subunit 7	-	HPRD,BioGRID	10602502
DBNL	ABP1 \| HIP-55 \| SH3P7	drebrin-like	Affinity Capture-MS	BioGRID	17353931
GEMIN4	DKFZp434B131 \| DKFZp434D174 \| HC56 \| HCAP1 \| HHRF-1 \| p97	gem (nuclear organelle) associated protein 4	Affinity Capture-MS	BioGRID	17353931
IFI27	FAM14D \| ISG12 \| ISG12A \| P27	interferon, alpha-inducible protein 27	-	HPRD	9837900
LYN	FLJ26625 \| JTK8	v-yes-1 Yamaguchi sarcoma viral related oncogene homolog	Affinity Capture-MS	BioGRID	17353931
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	MYC (c-Myc) interacts with CDK4 promoter.	BIND	12857727
MYOD1	MYF3 \| MYOD \| PUM \| bHLHc1	myogenic differentiation 1	-	HPRD,BioGRID	10022835 \|10601020
ORC3L	LAT \| LATHEO \| ORC3	origin recognition complex, subunit 3-like (yeast)	-	HPRD	15232106
PCNA	MGC8367	proliferating cell nuclear antigen	Affinity Capture-Western	BioGRID	8259215
PSMD10	dJ889N15.2 \| p28	proteasome (prosome, macropain) 26S subunit, non-ATPase, 10	-	HPRD,BioGRID	11779854
PTMA	MGC104802 \| TMSA	prothymosin, alpha	-	HPRD	11310559
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	CDK4 phosphorylates Rb carboxy-terminus. This interaction was modelled on a demonstrated interaction between human Rb and mouse CDK4.	BIND	15241418
RFC1	A1 \| MGC51786 \| MHCBFB \| PO-GA \| RECC1 \| RFC \| RFC140	replication factor C (activator 1) 1, 145kDa	-	HPRD,BioGRID	10353443
RPRM	FLJ90327 \| REPRIMO	reprimo, TP53 dependent G2 arrest mediator candidate	Affinity Capture-MS	BioGRID	17353931
SERTAD1	SEI1 \| TRIP-Br1	SERTA domain containing 1	-	HPRD,BioGRID	10580009 \|15065884
SETDB1	ESET \| KG1T \| KIAA0067 \| KMT1E	SET domain, bifurcated 1	Two-hybrid	BioGRID	16169070
SMAD2	JV18 \| JV18-1 \| MADH2 \| MADR2 \| MGC22139 \| MGC34440 \| hMAD-2 \| hSMAD2	SMAD family member 2	CDK4 phosphorylates Smad2. This interaction was modelled on a demonstrated interaction between Smad2 from an unspecified species and mouse CDK4.	BIND	15241418
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	CDK4 phosphorylates Smad3 on Thr8, Thr179, Ser204, Ser208 and Ser213. This interaction was modelled on a demonstrated interaction between Smad3 from an unspecified species and mouse CDK4.	BIND	15241418
SMC1A	CDLS2 \| DKFZp686L19178 \| DXS423E \| KIAA0178 \| MGC138332 \| SB1.8 \| SMC1 \| SMC1L1 \| SMC1alpha \| SMCB	structural maintenance of chromosomes 1A	Affinity Capture-MS	BioGRID	17353931
SMC3	BAM \| BMH \| CDLS3 \| CSPG6 \| HCAP \| SMC3L1	structural maintenance of chromosomes 3	Affinity Capture-MS	BioGRID	17353931
UBXN1	2B28 \| UBXD10	UBX domain protein 1	Affinity Capture-MS	BioGRID	17353931
VTA1	C6orf55 \| DRG-1 \| DRG1 \| FLJ27228 \| HSPC228 \| LIP5 \| My012 \| SBP1	Vps20-associated 1 homolog (S. cerevisiae)	Two-hybrid	BioGRID	16189514

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CELL CYCLE	128	84	All SZGR 2.0 genes in this pathway
KEGG P53 SIGNALING PATHWAY	69	45	All SZGR 2.0 genes in this pathway
KEGG TIGHT JUNCTION	134	86	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG PANCREATIC CANCER	70	56	All SZGR 2.0 genes in this pathway
KEGG GLIOMA	65	56	All SZGR 2.0 genes in this pathway
KEGG MELANOMA	71	57	All SZGR 2.0 genes in this pathway
KEGG BLADDER CANCER	42	33	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
KEGG SMALL CELL LUNG CANCER	84	67	All SZGR 2.0 genes in this pathway
KEGG NON SMALL CELL LUNG CANCER	54	47	All SZGR 2.0 genes in this pathway
BIOCARTA G1 PATHWAY	28	21	All SZGR 2.0 genes in this pathway
BIOCARTA CELLCYCLE PATHWAY	23	15	All SZGR 2.0 genes in this pathway
BIOCARTA RACCYCD PATHWAY	26	23	All SZGR 2.0 genes in this pathway
BIOCARTA P53 PATHWAY	16	13	All SZGR 2.0 genes in this pathway
BIOCARTA RB PATHWAY	13	11	All SZGR 2.0 genes in this pathway
SA G1 AND S PHASES	15	10	All SZGR 2.0 genes in this pathway
SA REG CASCADE OF CYCLIN EXPR	13	7	All SZGR 2.0 genes in this pathway
PID SMAD2 3NUCLEAR PATHWAY	82	63	All SZGR 2.0 genes in this pathway
PID NFAT TFPATHWAY	47	39	All SZGR 2.0 genes in this pathway
PID MYC ACTIV PATHWAY	79	62	All SZGR 2.0 genes in this pathway
PID ATF2 PATHWAY	59	43	All SZGR 2.0 genes in this pathway
PID FOXM1 PATHWAY	40	30	All SZGR 2.0 genes in this pathway
PID RB 1PATHWAY	65	46	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME MEIOSIS	116	81	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE	421	253	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE MITOTIC	325	185	All SZGR 2.0 genes in this pathway
REACTOME G1 PHASE	38	23	All SZGR 2.0 genes in this pathway
REACTOME MITOTIC G1 G1 S PHASES	137	79	All SZGR 2.0 genes in this pathway
REACTOME TRANSCRIPTIONAL REGULATION OF WHITE ADIPOCYTE DIFFERENTIATION	72	53	All SZGR 2.0 genes in this pathway
REACTOME MEIOTIC RECOMBINATION	86	62	All SZGR 2.0 genes in this pathway
REACTOME S PHASE	109	66	All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA UP	305	185	All SZGR 2.0 genes in this pathway
RHEIN ALL GLUCOCORTICOID THERAPY DN	362	238	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP	316	190	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
CAIRO PML TARGETS BOUND BY MYC UP	23	17	All SZGR 2.0 genes in this pathway
JOHANSSON GLIOMAGENESIS BY PDGFB UP	58	44	All SZGR 2.0 genes in this pathway
NUNODA RESPONSE TO DASATINIB IMATINIB UP	29	20	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 1	45	27	All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 21	9	5	All SZGR 2.0 genes in this pathway
HEIDENBLAD AMPLIFIED IN SOFT TISSUE CANCER	13	7	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK	101	73	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
LOCKWOOD AMPLIFIED IN LUNG CANCER	214	139	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
BENPORATH MYC TARGETS WITH EBOX	230	156	All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 5	18	11	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 12Q13 Q21 AMPLICON	46	21	All SZGR 2.0 genes in this pathway
TCGA GLIOBLASTOMA COPY NUMBER UP	75	36	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS UP	145	91	All SZGR 2.0 genes in this pathway
MENSSEN MYC TARGETS	53	35	All SZGR 2.0 genes in this pathway
SCHUHMACHER MYC TARGETS UP	80	57	All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE DN	245	154	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
HOFMANN CELL LYMPHOMA UP	50	35	All SZGR 2.0 genes in this pathway
LEI MYB TARGETS	318	215	All SZGR 2.0 genes in this pathway
BROWN MYELOID CELL DEVELOPMENT DN	129	86	All SZGR 2.0 genes in this pathway
ABRAHAM ALPC VS MULTIPLE MYELOMA DN	19	14	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER HEREDITARY VS SPORADIC	50	32	All SZGR 2.0 genes in this pathway
JOSEPH RESPONSE TO SODIUM BUTYRATE DN	64	45	All SZGR 2.0 genes in this pathway
PAL PRMT5 TARGETS UP	203	135	All SZGR 2.0 genes in this pathway
WU HBX TARGETS 3 UP	18	11	All SZGR 2.0 genes in this pathway
MACLACHLAN BRCA1 TARGETS UP	21	16	All SZGR 2.0 genes in this pathway
GERHOLD ADIPOGENESIS DN	64	44	All SZGR 2.0 genes in this pathway
ZHANG RESPONSE TO CANTHARIDIN DN	69	46	All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM UP	84	58	All SZGR 2.0 genes in this pathway
MODY HIPPOCAMPUS PRENATAL	42	33	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX DN	88	58	All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER BRCA1 VS BRCA2	163	113	All SZGR 2.0 genes in this pathway
LY AGING OLD DN	56	35	All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS DN	141	92	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 9	92	59	All SZGR 2.0 genes in this pathway
BILD MYC ONCOGENIC SIGNATURE	206	117	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS REQUIRE MYC	210	123	All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C	463	262	All SZGR 2.0 genes in this pathway
MATZUK CENTRAL FOR FEMALE FERTILITY	29	25	All SZGR 2.0 genes in this pathway
MATZUK LUTEAL GENES	8	5	All SZGR 2.0 genes in this pathway
WHITEFORD PEDIATRIC CANCER MARKERS	116	63	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER SURVIVAL DN	175	103	All SZGR 2.0 genes in this pathway
ZHAN VARIABLE EARLY DIFFERENTIATION GENES DN	30	19	All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS UNANNOTATED DN	193	112	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP	207	143	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
DANG MYC TARGETS UP	143	100	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
WONG EMBRYONIC STEM CELL CORE	335	193	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14	143	86	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 17	181	101	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
LE NEURONAL DIFFERENTIATION DN	19	16	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	131	138	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-486	258	264	1A	hsa-miR-486	UCCUGUACUGAGCUGCCCCGAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CDK4